https://happykhan.com/microbinfie en All rights reserved Microbial Bioinformatics is a rapidly changing field marrying computer science and microbiology. Join us as we share some tips and tricks we've learnt over the years. If you're student just getting to grips to the field, or someone who just wants to keep tabs on the latest and greatest - this podcast is for you. Microbial Bioinformatics is a rapidly changing field Microbial Bioinformatics Microbial Bioinformatics is a rapidly changing field marrying computer science and microbiology. Join us as we share some tips and tricks we've learnt over the years. If you're student just getting to grips to the field, or someone who just wants to keep tabs on the latest and greatest - this podcast is for you. Micro Binfie Podcast microbinfie@gmail.com no tag:soundcloud,2010:tracks/2279092904 https://soundcloud.com/microbinfie/151-deacon-part-1 Thu, 26 Mar 2026 05:00:25 GMT 00:23:36 Microbial Bioinformatics no In this Software Deep Dive episode, we talk with … In this Software Deep Dive episode, we talk with Dr. Bede Constantinides (University of Birmingham) about Deacon, a tool for removing host DNA reads from metagenomic datasets. We discuss why host read removal is a deceptively difficult problem, the limitations of alignment-based approaches, and how Deacon evolved from Bede's earlier tool Hostile. The conversation covers practical issues such as human contamination in metagenomes, balancing sensitivity vs specificity when filtering reads, and the computational challenges of working with large human reference datasets and pangenomes. This episode focuses on the background and motivation for Deacon. The next episode will dive deeper into how the method works. Links Deacon https://github.com/bede/deacon Hostile https://github.com/bede/hostile/ Bede Constantinides http://bede.im/ nf-core taxprofiler https://nf-co.re/taxprofiler Kraken2 https://ccb.jhu.edu/software/kraken2/ (/microbinfie-transcripts/episode-151.txt) In this Software Deep Dive episode, we talk with Dr. Bede Constantinides (University of Birmingham) about Deacon, a tool for removing host DNA reads from metagenomic datasets. We discuss why host read removal is a deceptively difficult problem, the limitations of alignment-based approaches, and how Deacon evolved from Bede's earlier tool Hostile. The conversation covers practical issues such as human contamination in metagenomes, balancing sensitivity vs specificity when filtering reads, and the computational challenges of working with large human reference datasets and pangenomes. This episode focuses on the background and motivation for Deacon. The next episode will dive deeper into how the method works. Links Deacon https://github.com/bede/deacon Hostile https://github.com/bede/hostile/ Bede Constantinides http://bede.im/ nf-core taxprofiler https://nf-co.re/taxprofiler Kraken2 https://ccb.jhu.edu/software/kraken2/ (/microbinfie-transcripts/episode-151.txt) tag:soundcloud,2010:tracks/2279061284 https://soundcloud.com/microbinfie/150-genomicx Thu, 12 Mar 2026 05:00:06 GMT 00:43:07 Microbial Bioinformatics no In this episode, Lee, Nabil, and Andrew experimen… In this episode, Lee, Nabil, and Andrew experiment with “vibe coding” bioinformatics tools using AI coding assistants. The goal: quickly build useful genomics utilities that run entirely in the browser via WebAssembly, without requiring command-line installs or servers. Nabil states: “Even if you don’t want to use this technology, you should pay attention - because everyone else will.” They discuss how existing bioinformatics programs can be compiled to WebAssembly and wrapped with simple browser interfaces so analyses run locally on a user’s machine. This keeps genomic data private while making tools easier to access. The prototype tools discussed in the episode are available here: https://genomicx.github.io/ These examples show how browser-based bioinformatics might work for lightweight tasks such as genome comparisons and basic sequence analysis. Topics Covered Using AI tools to rapidly prototype bioinformatics software Compiling genomics programs to WebAssembly Running analyses locally in the browser Privacy advantages of keeping genomic... Read more at https://happykhan.com/microbinfie/mb-150-genomicx In this episode, Lee, Nabil, and Andrew experiment with “vibe coding” bioinformatics tools using AI coding assistants. The goal: quickly build useful genomics utilities that run entirely in the browser via WebAssembly, without requiring command-line installs or servers. Nabil states: “Even if you don’t want to use this technology, you should pay attention - because everyone else will.” They discuss how existing bioinformatics programs can be compiled to WebAssembly and wrapped with simple browser interfaces so analyses run locally on a user’s machine. This keeps genomic data private while making tools easier to access. The prototype tools discussed in the episode are available here: https://genomicx.github.io/ These examples show how browser-based bioinformatics might work for lightweight tasks such as genome comparisons and basic sequence analysis. Topics Covered Using AI tools to rapidly prototype bioinformatics software Compiling genomics programs to WebAssembly Running analyses locally in the browser Privacy advantages of keeping genomic... Read more at https://happykhan.com/microbinfie/mb-150-genomicx tag:soundcloud,2010:tracks/2261246297 https://soundcloud.com/microbinfie/bridging-ai-biosciences Mon, 09 Feb 2026 09:00:24 GMT 00:35:53 Microbial Bioinformatics no Join hosts Kieren Sharma (Artificially Ever After… Join hosts Kieren Sharma (Artificially Ever After podcast, University of Bristol) and Andrew Page (MicroBinfie podcast, Origin Sciences) for a compelling live panel discussion exploring the dynamic intersection of artificial intelligence and the biosciences. In this episode, our expert panel discusses: 🔬 The AI Revolution in Biology - How machine learning and deep learning have transformed everything from microscopy image processing to drug discovery, enabling researchers to move from analyzing single images to conducting statistical analysis on massive datasets. 🤖 The LLM Era - Real experiences with generative AI tools like ChatGPT and Claude in research workflows, from accelerating literature reviews to writing thousands of lines of code through prompt engineering rather than manual coding. ⚖️ Finding Balance - When AI is genuinely transformative versus when it's just hype, including practical guidance on choosing between sophisticated transformer models and simpler, more energy-efficient approaches like random forests. 🔒 Safety & Trust... Read more at https://happykhan.com/microbinfie/mb-149-bridging-ai-biosciences Join hosts Kieren Sharma (Artificially Ever After podcast, University of Bristol) and Andrew Page (MicroBinfie podcast, Origin Sciences) for a compelling live panel discussion exploring the dynamic intersection of artificial intelligence and the biosciences. In this episode, our expert panel discusses: 🔬 The AI Revolution in Biology - How machine learning and deep learning have transformed everything from microscopy image processing to drug discovery, enabling researchers to move from analyzing single images to conducting statistical analysis on massive datasets. 🤖 The LLM Era - Real experiences with generative AI tools like ChatGPT and Claude in research workflows, from accelerating literature reviews to writing thousands of lines of code through prompt engineering rather than manual coding. ⚖️ Finding Balance - When AI is genuinely transformative versus when it's just hype, including practical guidance on choosing between sophisticated transformer models and simpler, more energy-efficient approaches like random forests. 🔒 Safety & Trust... Read more at https://happykhan.com/microbinfie/mb-149-bridging-ai-biosciences tag:soundcloud,2010:tracks/2194492795 https://soundcloud.com/microbinfie/nextflow-debate-3 Thu, 13 Nov 2025 06:00:18 GMT 00:24:20 Microbial Bioinformatics no Final part of our discussion/debate on NextFlow This episode examines whether Nextflow continues to be the best solution for bioinformatics workflows in an era of rapid development, AI integration, and evolving alternatives. We discuss scalability, community standards, AI’s growing influence, and historical perspectives on workflow management tools. Key Points Scalability and Maintenance Nextflow benefits from a large, active community and commercial support, ensuring long-term stability. Frequent updates improve features but can break workflows, especially when using customized modules. Keeping forks aligned with NF-Core modules requires significant effort unless contributions are merged upstream. While the fast development pace is positive, it demands continuous testing and version management for production use. Community and Standards NF-Core provides a strong, opinionated framework that standardizes pipelines, promoting reproducibility and collaboration. However, strict adherence can limit flexibility for specialized use cases. Some developers fork and adapt pipelines to suit their needs, accepting the cost of maintaining those versions. Cost and Ecosystem Tools Tools... Read more at https://happykhan.com/microbinfie/mb-148-nextflow-debate-3 This episode examines whether Nextflow continues to be the best solution for bioinformatics workflows in an era of rapid development, AI integration, and evolving alternatives. We discuss scalability, community standards, AI’s growing influence, and historical perspectives on workflow management tools. Key Points Scalability and Maintenance Nextflow benefits from a large, active community and commercial support, ensuring long-term stability. Frequent updates improve features but can break workflows, especially when using customized modules. Keeping forks aligned with NF-Core modules requires significant effort unless contributions are merged upstream. While the fast development pace is positive, it demands continuous testing and version management for production use. Community and Standards NF-Core provides a strong, opinionated framework that standardizes pipelines, promoting reproducibility and collaboration. However, strict adherence can limit flexibility for specialized use cases. Some developers fork and adapt pipelines to suit their needs, accepting the cost of maintaining those versions. Cost and Ecosystem Tools Tools... Read more at https://happykhan.com/microbinfie/mb-148-nextflow-debate-3 tag:soundcloud,2010:tracks/2189256127 https://soundcloud.com/microbinfie/147-nextflow-debate-2 Thu, 30 Oct 2025 05:26:59 GMT 00:15:13 Microbial Bioinformatics no Part two of debating NextFlow This episode explores whether Nextflow remains the best choice for bioinformatics workflows amid growing alternatives and AI-assisted development tools. The discussion focuses on portability, robustness, documentation quality, and the balance between developer complexity and user convenience. Key Points Portability Nextflow enables pipelines to run on local machines, HPC systems, and cloud platforms (AWS Batch, Google Batch) with minimal modification. Containerization (Docker, Conda) ensures consistent environments and reproducible results. Troubleshooting can be difficult because executables are embedded within containers, requiring manual inspection and container rebuilding. Configuration files may differ across systems and sometimes expose sensitive details about computational infrastructure. Poorly configured logging in cloud environments can lead to unexpected costs. Robustness and Fault Tolerance Built-in checkpointing allows workflows to restart after failure without full reruns. When configured properly, Nextflow can handle job interruptions and resource scaling efficiently. Incorrect configurations or software bugs can cause excessive resource requests or pipeline failures, particularly... Read more at https://happykhan.com/microbinfie/mb-147-nextflow-debate-2 This episode explores whether Nextflow remains the best choice for bioinformatics workflows amid growing alternatives and AI-assisted development tools. The discussion focuses on portability, robustness, documentation quality, and the balance between developer complexity and user convenience. Key Points Portability Nextflow enables pipelines to run on local machines, HPC systems, and cloud platforms (AWS Batch, Google Batch) with minimal modification. Containerization (Docker, Conda) ensures consistent environments and reproducible results. Troubleshooting can be difficult because executables are embedded within containers, requiring manual inspection and container rebuilding. Configuration files may differ across systems and sometimes expose sensitive details about computational infrastructure. Poorly configured logging in cloud environments can lead to unexpected costs. Robustness and Fault Tolerance Built-in checkpointing allows workflows to restart after failure without full reruns. When configured properly, Nextflow can handle job interruptions and resource scaling efficiently. Incorrect configurations or software bugs can cause excessive resource requests or pipeline failures, particularly... Read more at https://happykhan.com/microbinfie/mb-147-nextflow-debate-2 tag:soundcloud,2010:tracks/2188229951 https://soundcloud.com/microbinfie/146-nextflow-debate-1 Thu, 16 Oct 2025 06:00:44 GMT 00:18:32 Microbial Bioinformatics no Andrew, Nabil, and Lee debate about NextFlow! This episode begins a discussion on the continued relevance of Nextflow in 2025. We explore whether Nextflow still represents the optimal workflow engine for bioinformatics, weighing its portability, modularity, and performance against its learning curve, debugging challenges, and operational costs. Key Points Overview and Framing The goal of the series is to share practical, experience-based insights in microbial bioinformatics that are often undocumented. The focus of this episode is the Nextflow workflow management system, assessing its strengths, weaknesses, and role in the evolving bioinformatics landscape. Popularity and Context in 2025 Nextflow remains widely adopted for portability, scalability, and reproducibility. It integrates smoothly with cloud computing environments such as AWS and Seqera Tower. Despite its maturity, users continue to face complex syntax, debugging frustrations, and workflow management difficulties. Performance and Efficiency Performance depends largely on the user’s code quality and workflow design rather than Nextflow itself. When implemented well, Nextflow efficiently... Read more at https://happykhan.com/microbinfie/mb-146-nextflow-debate-1 This episode begins a discussion on the continued relevance of Nextflow in 2025. We explore whether Nextflow still represents the optimal workflow engine for bioinformatics, weighing its portability, modularity, and performance against its learning curve, debugging challenges, and operational costs. Key Points Overview and Framing The goal of the series is to share practical, experience-based insights in microbial bioinformatics that are often undocumented. The focus of this episode is the Nextflow workflow management system, assessing its strengths, weaknesses, and role in the evolving bioinformatics landscape. Popularity and Context in 2025 Nextflow remains widely adopted for portability, scalability, and reproducibility. It integrates smoothly with cloud computing environments such as AWS and Seqera Tower. Despite its maturity, users continue to face complex syntax, debugging frustrations, and workflow management difficulties. Performance and Efficiency Performance depends largely on the user’s code quality and workflow design rather than Nextflow itself. When implemented well, Nextflow efficiently... Read more at https://happykhan.com/microbinfie/mb-146-nextflow-debate-1 tag:soundcloud,2010:tracks/2158645479 https://soundcloud.com/microbinfie/144-micro-binfie-pathoplexus-part-2 Thu, 25 Sep 2025 06:55:06 GMT 00:20:52 Microbial Bioinformatics no Nabil and Lee bring a guest host Clint to talk wi… In this episode of the microbinfie podcast, the hosts discuss Pathoplexus, an innovative pathogen genomics database with a unique community-driven governance model and open-source approach. Nabil and Lee bring a guest host Clint to talk with some of the people behind Pathoplexus http://pathoplexus.org/ Key Points Database Governance Established as a Swiss 'Verein' (association) with community accountability Members can vote out executive board if unsatisfied with direction Designed to serve the pathogen genomics and public health community Open-Source and Transparency Everything is open-source and hosted on GitHub Users can raise issues, request features, and report sequence errors Encourages community participation and continuous improvement Data Sharing and Commercial Use Allows sequence uploads with flexible usage terms Acknowledges challenges of pathogen access and benefit sharing Aims to remain adaptable to future global solutions Take-Home Messages Community-driven databases can revolutionize scientific data sharing Transparent governance is crucial for scientific infrastructure Open-source platforms enable rapid... Read more at https://happykhan.com/microbinfie/mb-145-micro-binfie-pathoplexus-part-2 In this episode of the microbinfie podcast, the hosts discuss Pathoplexus, an innovative pathogen genomics database with a unique community-driven governance model and open-source approach. Nabil and Lee bring a guest host Clint to talk with some of the people behind Pathoplexus http://pathoplexus.org/ Key Points Database Governance Established as a Swiss 'Verein' (association) with community accountability Members can vote out executive board if unsatisfied with direction Designed to serve the pathogen genomics and public health community Open-Source and Transparency Everything is open-source and hosted on GitHub Users can raise issues, request features, and report sequence errors Encourages community participation and continuous improvement Data Sharing and Commercial Use Allows sequence uploads with flexible usage terms Acknowledges challenges of pathogen access and benefit sharing Aims to remain adaptable to future global solutions Take-Home Messages Community-driven databases can revolutionize scientific data sharing Transparent governance is crucial for scientific infrastructure Open-source platforms enable rapid... Read more at https://happykhan.com/microbinfie/mb-145-micro-binfie-pathoplexus-part-2 tag:soundcloud,2010:tracks/2158644894 https://soundcloud.com/microbinfie/micro-binfie-pathoplexus-part Thu, 11 Sep 2025 06:53:31 GMT 00:22:47 Microbial Bioinformatics no Nabil and Lee bring a guest host Clint to talk wi… The microbinfie podcast explores Pathoplexus, an innovative platform designed to facilitate viral genome data sharing while addressing researchers' concerns about publication credit and data accessibility. Nabil and Lee bring a guest host Clint to talk with some of the people behind Pathoplexus http://pathoplexus.org/ Key Points Pathoplexus Platform Virus genome database allowing researchers to share sequences Supports both open and restricted-use data sharing models Provides immediate pre-processing of uploaded sequences using tools like Nextclade Data Sharing Innovation Addresses researchers' fear of being "scooped" through restricted-use option Allows public health use of sequences before publication Supports aggregate analysis while protecting individual researchers' interests Community-Driven Development Currently hosts genomic data for viruses like Ebola, West Nile, mPox, RSV Selects new pathogens based on community input and public health needs Implements innovative citation tracking through sequence set DOIs Take-Home Messages Pathoplexus revolutionizes viral genomic data sharing Balances open science with researchers' publication concerns Provides... Read more at https://happykhan.com/microbinfie/mb-144-micro-binfie-pathoplexus-part-1 The microbinfie podcast explores Pathoplexus, an innovative platform designed to facilitate viral genome data sharing while addressing researchers' concerns about publication credit and data accessibility. Nabil and Lee bring a guest host Clint to talk with some of the people behind Pathoplexus http://pathoplexus.org/ Key Points Pathoplexus Platform Virus genome database allowing researchers to share sequences Supports both open and restricted-use data sharing models Provides immediate pre-processing of uploaded sequences using tools like Nextclade Data Sharing Innovation Addresses researchers' fear of being "scooped" through restricted-use option Allows public health use of sequences before publication Supports aggregate analysis while protecting individual researchers' interests Community-Driven Development Currently hosts genomic data for viruses like Ebola, West Nile, mPox, RSV Selects new pathogens based on community input and public health needs Implements innovative citation tracking through sequence set DOIs Take-Home Messages Pathoplexus revolutionizes viral genomic data sharing Balances open science with researchers' publication concerns Provides... Read more at https://happykhan.com/microbinfie/mb-144-micro-binfie-pathoplexus-part-1 tag:soundcloud,2010:tracks/2157716388 https://soundcloud.com/microbinfie/143-where-we-catch-up-on-our-professional-lives Thu, 28 Aug 2025 06:35:38 GMT 00:13:05 Microbial Bioinformatics no 143 - where we catch up on our professional lives… In this personal update episode, the microbinfie podcast hosts discuss their recent professional transitions and current work, offering insights into their evolving careers in microbial bioinformatics and computational biology. Key Points Professional Transitions Andrew Page moved to Origin Sciences, focusing on cancer diagnostic devices Nabil transitioned to the Centre for Genomic Pathogen Surveillance at Oxford University Lee Katz continues working in bioinformatics in the United States Innovative Research Andrew developing non-invasive diagnostic tools for colorectal and gynecological cancers Research involves microbiome analysis and genomic sequencing for early cancer detection Focus on reducing unnecessary medical procedures and improving screening efficiency Collaborative Connections Maintained professional connections through the Genome Campus Continued collaboration and crossing paths in scientific research Take-Home Messages Bioinformatics careers are dynamic and constantly evolving Innovative technologies can transform medical diagnostics Professional networks remain crucial in scientific research In this personal update episode, the microbinfie podcast hosts discuss their recent professional transitions and current work, offering insights into their evolving careers in microbial bioinformatics and computational biology. Key Points Professional Transitions Andrew Page moved to Origin Sciences, focusing on cancer diagnostic devices Nabil transitioned to the Centre for Genomic Pathogen Surveillance at Oxford University Lee Katz continues working in bioinformatics in the United States Innovative Research Andrew developing non-invasive diagnostic tools for colorectal and gynecological cancers Research involves microbiome analysis and genomic sequencing for early cancer detection Focus on reducing unnecessary medical procedures and improving screening efficiency Collaborative Connections Maintained professional connections through the Genome Campus Continued collaboration and crossing paths in scientific research Take-Home Messages Bioinformatics careers are dynamic and constantly evolving Innovative technologies can transform medical diagnostics Professional networks remain crucial in scientific research tag:soundcloud,2010:tracks/2140006038 https://soundcloud.com/microbinfie/microbinfie-genomeqc Thu, 07 Aug 2025 09:00:16 GMT 00:26:42 Microbial Bioinformatics no The crew talks about the genomeqc ecosystem. Chec… In this episode of the microbinfie podcast, Nabil-Fareed Alikhan introduces GenomeQC, a comprehensive approach to establishing species-specific genome quality control thresholds for bacterial genomics. Errata: The project name was changed to qualibact and is no longer genomeqc as mentioned on the episode. See more at the Qualibact website Key Points Genome Quality Assessment Addresses the challenge of determining genome assembly quality metrics Provides species-specific thresholds for genome size, contig count, and other parameters Helps researchers understand what constitutes a 'good' genome assembly Data and Methodology Leverages 1.2 million bacterial genome assemblies for analysis Uses Illumina-based assemblies as primary reference Computationally lightweight, taking only half a day to process on a compute cluster Future Development Plans to create a command-line tool with traffic light-style quality reporting Aims to make thresholds easily implementable in various bioinformatics pipelines Open to expanding analysis to different taxonomic levels Take-Home Messages Genome quality assessment requires nuanced,... Read more at https://happykhan.com/microbinfie/mb-142-microbinfie-genomeqc In this episode of the microbinfie podcast, Nabil-Fareed Alikhan introduces GenomeQC, a comprehensive approach to establishing species-specific genome quality control thresholds for bacterial genomics. Errata: The project name was changed to qualibact and is no longer genomeqc as mentioned on the episode. See more at the Qualibact website Key Points Genome Quality Assessment Addresses the challenge of determining genome assembly quality metrics Provides species-specific thresholds for genome size, contig count, and other parameters Helps researchers understand what constitutes a 'good' genome assembly Data and Methodology Leverages 1.2 million bacterial genome assemblies for analysis Uses Illumina-based assemblies as primary reference Computationally lightweight, taking only half a day to process on a compute cluster Future Development Plans to create a command-line tool with traffic light-style quality reporting Aims to make thresholds easily implementable in various bioinformatics pipelines Open to expanding analysis to different taxonomic levels Take-Home Messages Genome quality assessment requires nuanced,... Read more at https://happykhan.com/microbinfie/mb-142-microbinfie-genomeqc tag:soundcloud,2010:tracks/1947893671 https://soundcloud.com/microbinfie/137-exploring-clinical-metagenomics Thu, 03 Jul 2025 09:00:09 GMT 00:22:54 Microbial Bioinformatics no In this episode of the Podcast, hosts Lee Katz an… In this episode of the Podcast, hosts Lee Katz and Andrew Page delve into the intricacies of clinical metagenomics. Joined by experts Torsten Seemann and Finlay Maguire, they explore the challenges and methodologies involved in identifying pathogens in clinical samples when traditional diagnostic methods fail. They discuss the types of samples analyzed, the impact of low DNA concentrations, and the complexities of sequencing data interpretation. The conversation highlights the importance of interdisciplinary collaboration between bioinformaticians and clinicians in managing difficult infections. Despite the hurdles, clinical metagenomics is presented as a complementary tool aiding in diagnosis, emphasizing the need for genomic literacy among healthcare professionals. Key Points Clinical Metagenomics Workflow Used when traditional microbiological methods cannot identify pathogens Involves heavy sequencing of clinical samples like blood, CSF, and skin swabs Requires interdisciplinary collaboration between bioinformaticians and clinicians Analytical Challenges High human DNA contamination in samples complicates pathogen detection Polymicrobial infections and... Read more at https://happykhan.com/microbinfie/mb-140-exploring-clinical-metagenomics In this episode of the Podcast, hosts Lee Katz and Andrew Page delve into the intricacies of clinical metagenomics. Joined by experts Torsten Seemann and Finlay Maguire, they explore the challenges and methodologies involved in identifying pathogens in clinical samples when traditional diagnostic methods fail. They discuss the types of samples analyzed, the impact of low DNA concentrations, and the complexities of sequencing data interpretation. The conversation highlights the importance of interdisciplinary collaboration between bioinformaticians and clinicians in managing difficult infections. Despite the hurdles, clinical metagenomics is presented as a complementary tool aiding in diagnosis, emphasizing the need for genomic literacy among healthcare professionals. Key Points Clinical Metagenomics Workflow Used when traditional microbiological methods cannot identify pathogens Involves heavy sequencing of clinical samples like blood, CSF, and skin swabs Requires interdisciplinary collaboration between bioinformaticians and clinicians Analytical Challenges High human DNA contamination in samples complicates pathogen detection Polymicrobial infections and... Read more at https://happykhan.com/microbinfie/mb-140-exploring-clinical-metagenomics tag:soundcloud,2010:tracks/1947906575 https://soundcloud.com/microbinfie/137-lassa-virus-genomics Thu, 19 Jun 2025 09:00:04 GMT 00:15:29 Microbial Bioinformatics no On this episode we are joined by Sara Zufan to di… On this episode we are joined by Sara Zufan to discuss her PhD journey and recent projects. The episode covers various research experiences and challenges in the field, including the rapid detection of AMR using nanopore sequencing, COVID-19 projects, hepatitis A outbreak investigations, and Lassa virus surveillance in Liberia. The guests share insights into their professional journeys, their experiences working across different continents, and the future of microbial bioinformatics research. Key Points Research Trajectory Completed PhD exploring intersection of public health and genomics Worked on rapid AMR detection using nanopore sequencing Conducted COVID-19 and hepatitis A research projects Lassa Virus Research Currently developing wastewater surveillance for Lassa virus in Liberia Working on understanding viral genetic diversity and genomic detection methods Collaborating with NIH and USDA on one-health approach to pathogen monitoring Interdisciplinary Approach Combines wet lab and computational techniques Experienced in international research environments (Australia, USA, Liberia) Skilled in genomic... Read more at https://happykhan.com/microbinfie/mb-139-lassa-virus-genomics On this episode we are joined by Sara Zufan to discuss her PhD journey and recent projects. The episode covers various research experiences and challenges in the field, including the rapid detection of AMR using nanopore sequencing, COVID-19 projects, hepatitis A outbreak investigations, and Lassa virus surveillance in Liberia. The guests share insights into their professional journeys, their experiences working across different continents, and the future of microbial bioinformatics research. Key Points Research Trajectory Completed PhD exploring intersection of public health and genomics Worked on rapid AMR detection using nanopore sequencing Conducted COVID-19 and hepatitis A research projects Lassa Virus Research Currently developing wastewater surveillance for Lassa virus in Liberia Working on understanding viral genetic diversity and genomic detection methods Collaborating with NIH and USDA on one-health approach to pathogen monitoring Interdisciplinary Approach Combines wet lab and computational techniques Experienced in international research environments (Australia, USA, Liberia) Skilled in genomic... Read more at https://happykhan.com/microbinfie/mb-139-lassa-virus-genomics tag:soundcloud,2010:tracks/1947875419 https://soundcloud.com/microbinfie/decoding-tetracycline-resistance-in-mrsa Thu, 16 Jan 2025 05:00:06 GMT 00:11:24 Microbial Bioinformatics no In this episode of the Micro Binfie Podcast, host… In this episode of the Micro Binfie Podcast, host Andrew Page takes listeners to the heart of the microbial genomics hackathon in Bethesda, Maryland, for an engaging conversation with special guest Megan Phillips, a PhD student from Emory University. Megan delves into her research on Staphylococcus aureus (MRSA), highlighting its fascinating dual nature as both a harmless and potentially serious pathogen. Megan discusses the complexities of tetracycline resistance, particularly focusing on plasmid-mediated mechanisms involving the pt181 plasmid. She explains how this plasmid’s efflux pump, encoded by the gene tetK, contributes to variable resistance levels and the factors influencing MIC (Minimum Inhibitory Concentration) variability. Listeners will learn about the intricacies of plasmid copy numbers, their global spread across clonal complexes, and the occurrence of horizontal and vertical gene transfer. Throughout the episode, Megan shares insights on working with short-read sequencing data and the strategies she employs to detect plasmid presence using... Read more at https://happykhan.com/microbinfie/mb-138-decoding-tetracycline-resistance-in-mrsa In this episode of the Micro Binfie Podcast, host Andrew Page takes listeners to the heart of the microbial genomics hackathon in Bethesda, Maryland, for an engaging conversation with special guest Megan Phillips, a PhD student from Emory University. Megan delves into her research on Staphylococcus aureus (MRSA), highlighting its fascinating dual nature as both a harmless and potentially serious pathogen. Megan discusses the complexities of tetracycline resistance, particularly focusing on plasmid-mediated mechanisms involving the pt181 plasmid. She explains how this plasmid’s efflux pump, encoded by the gene tetK, contributes to variable resistance levels and the factors influencing MIC (Minimum Inhibitory Concentration) variability. Listeners will learn about the intricacies of plasmid copy numbers, their global spread across clonal complexes, and the occurrence of horizontal and vertical gene transfer. Throughout the episode, Megan shares insights on working with short-read sequencing data and the strategies she employs to detect plasmid presence using... Read more at https://happykhan.com/microbinfie/mb-138-decoding-tetracycline-resistance-in-mrsa tag:soundcloud,2010:tracks/1986885879 https://soundcloud.com/microbinfie/136-contagion-part-2 Thu, 02 Jan 2025 00:00:00 GMT 00:32:26 Microbial Bioinformatics no In a two-part discussion, the hosts analyze the m… In a two-part discussion, the hosts analyze the movie Contagion from their expert perspectives, focusing on the film's portrayal of epidemiology and genomics. They note that the movie compresses timelines for dramatic effect, speeding up the virus's spread and the response to it, and that decisions about managing a crisis are based on societal values, not just science. In part one, the hosts discuss the movie's depiction of the R0 value. They note that while this explanation is useful for the audience, it is unlikely that an epidemiologist would need to explain this concept to other epidemiologists. The group notes that the MEV1 virus is modeled on the real-life Nipah virus and comment on a scene where the genome of the virus is described as being 15 to 19 kilobases in length with 6 to 10 genes. They also discuss the movie's depiction of virus isolation and the unrealistic speed... Read more at https://happykhan.com/microbinfie/mb-137-contagion-part-2 In a two-part discussion, the hosts analyze the movie Contagion from their expert perspectives, focusing on the film's portrayal of epidemiology and genomics. They note that the movie compresses timelines for dramatic effect, speeding up the virus's spread and the response to it, and that decisions about managing a crisis are based on societal values, not just science. In part one, the hosts discuss the movie's depiction of the R0 value. They note that while this explanation is useful for the audience, it is unlikely that an epidemiologist would need to explain this concept to other epidemiologists. The group notes that the MEV1 virus is modeled on the real-life Nipah virus and comment on a scene where the genome of the virus is described as being 15 to 19 kilobases in length with 6 to 10 genes. They also discuss the movie's depiction of virus isolation and the unrealistic speed... Read more at https://happykhan.com/microbinfie/mb-137-contagion-part-2 tag:soundcloud,2010:tracks/1933458959 https://soundcloud.com/microbinfie/134-assembling-atcc-bacterial-strains Thu, 19 Dec 2024 13:00:08 GMT 00:13:35 Microbial Bioinformatics no In this episode of the Micro Binfie podcast, host… In this episode of the Micro Binfie podcast, host Andrew Page is joined by Nikhita Puthuveetil, Senior Bioinformatician at the American Type Culture Collection (ATCC). They delve into ATCC's ambitious project of sequencing a vast array of organisms from their renowned collection, tackling the challenges of assembling complex genomes from bacteria, viruses, fungi, and more. Discover how Nikhita and her team navigate through genomic roadblocks, leverage cutting-edge sequencing technologies, and work to ensure accurate data provenance. Whether it's large viral genomes or evolving taxonomy, this episode offers a deep dive into the fascinating world of microbial bioinformatics and genomic curation. Key Points ATCC Genome Sequencing Project Sequencing over 5,000 genomes across multiple organism types Using both short-read and long-read sequencing platforms Focusing on challenging organisms like extremophiles and complex viruses Genome Assembly Challenges Developing flexible assembly pipelines for diverse genomic compositions Addressing issues with repetitive regions in herpes viruses Manually... Read more at https://happykhan.com/microbinfie/mb-135-assembling-atcc-bacterial-strains In this episode of the Micro Binfie podcast, host Andrew Page is joined by Nikhita Puthuveetil, Senior Bioinformatician at the American Type Culture Collection (ATCC). They delve into ATCC's ambitious project of sequencing a vast array of organisms from their renowned collection, tackling the challenges of assembling complex genomes from bacteria, viruses, fungi, and more. Discover how Nikhita and her team navigate through genomic roadblocks, leverage cutting-edge sequencing technologies, and work to ensure accurate data provenance. Whether it's large viral genomes or evolving taxonomy, this episode offers a deep dive into the fascinating world of microbial bioinformatics and genomic curation. Key Points ATCC Genome Sequencing Project Sequencing over 5,000 genomes across multiple organism types Using both short-read and long-read sequencing platforms Focusing on challenging organisms like extremophiles and complex viruses Genome Assembly Challenges Developing flexible assembly pipelines for diverse genomic compositions Addressing issues with repetitive regions in herpes viruses Manually... Read more at https://happykhan.com/microbinfie/mb-135-assembling-atcc-bacterial-strains tag:soundcloud,2010:tracks/1992914191 https://soundcloud.com/microbinfie/141-hackathon-panel Wed, 18 Dec 2024 00:00:00 GMT 00:15:20 Microbial Bioinformatics no Andrew, Lee, Torsten, and Fin muse over the futur… In this episode of the microbinfie podcast, hosts discuss emerging challenges and opportunities in microbial genomics, focusing on next-generation sequencing technologies, bioinformatics tools, and genomic analysis approaches. Key Points Nanopore Sequencing Technologies Increasing adoption in developing countries and resource-limited settings Challenges with variant calling and assembly accuracy Ongoing improvements in base calling and error correction Genomic Analysis Tools Need for more sophisticated MLST (Multi-Locus Sequence Typing) approaches Interest in structural variant analysis and complete genome representation Emerging tools for more comprehensive genomic characterization Sequencing Technology Landscape Continued dominance of Illumina in high-throughput settings Growing potential of nanopore for specialized genomic investigations Challenges in automated genome validation and analysis Take-Home Messages Nanopore technology is rapidly evolving but still requires refined bioinformatics tools Complete genome assemblies remain a challenging but important goal Machine learning approaches show promise in improving genomic analysis In this episode of the microbinfie podcast, hosts discuss emerging challenges and opportunities in microbial genomics, focusing on next-generation sequencing technologies, bioinformatics tools, and genomic analysis approaches. Key Points Nanopore Sequencing Technologies Increasing adoption in developing countries and resource-limited settings Challenges with variant calling and assembly accuracy Ongoing improvements in base calling and error correction Genomic Analysis Tools Need for more sophisticated MLST (Multi-Locus Sequence Typing) approaches Interest in structural variant analysis and complete genome representation Emerging tools for more comprehensive genomic characterization Sequencing Technology Landscape Continued dominance of Illumina in high-throughput settings Growing potential of nanopore for specialized genomic investigations Challenges in automated genome validation and analysis Take-Home Messages Nanopore technology is rapidly evolving but still requires refined bioinformatics tools Complete genome assemblies remain a challenging but important goal Machine learning approaches show promise in improving genomic analysis tag:soundcloud,2010:tracks/1986884843 https://soundcloud.com/microbinfie/135-contagion-part-1 Mon, 16 Dec 2024 00:00:00 GMT 00:30:43 Microbial Bioinformatics no In a two-part discussion, the hosts analyze the m… In a two-part discussion, the hosts analyze the movie Contagion from their expert perspectives, focusing on the film's portrayal of epidemiology and genomics. They note that the movie compresses timelines for dramatic effect, speeding up the virus's spread and the response to it, and that decisions about managing a crisis are based on societal values, not just science. In part one, the hosts discuss the movie's depiction of the R0 value. They note that while this explanation is useful for the audience, it is unlikely that an epidemiologist would need to explain this concept to other epidemiologists. The group notes that the MEV1 virus is modeled on the real-life Nipah virus and comment on a scene where the genome of the virus is described as being 15 to 19 kilobases in length with 6 to 10 genes. They also discuss the movie's depiction of virus isolation and the unrealistic speed... Read more at https://happykhan.com/microbinfie/mb-136-contagion-part-1 In a two-part discussion, the hosts analyze the movie Contagion from their expert perspectives, focusing on the film's portrayal of epidemiology and genomics. They note that the movie compresses timelines for dramatic effect, speeding up the virus's spread and the response to it, and that decisions about managing a crisis are based on societal values, not just science. In part one, the hosts discuss the movie's depiction of the R0 value. They note that while this explanation is useful for the audience, it is unlikely that an epidemiologist would need to explain this concept to other epidemiologists. The group notes that the MEV1 virus is modeled on the real-life Nipah virus and comment on a scene where the genome of the virus is described as being 15 to 19 kilobases in length with 6 to 10 genes. They also discuss the movie's depiction of virus isolation and the unrealistic speed... Read more at https://happykhan.com/microbinfie/mb-136-contagion-part-1 tag:soundcloud,2010:tracks/1933445948 https://soundcloud.com/microbinfie/diving-into-mrsa-genomics-and-public-health Thu, 05 Dec 2024 14:00:01 GMT 00:13:27 Microbial Bioinformatics no In this episode of the Micro Binfie Podcast, host… In this episode of the Micro Binfie Podcast, host Andrew Page speaks with Dr. Brooke Talbot, a recent PhD graduate from Emory University, about her research on Staphylococcus aureus, with a focus on MRSA and antibiotic resistance. Brooke shares insights into her molecular epidemiology work, discussing the complexities of tracking resistant bacterial strains in clinical settings and the significance of genomic epidemiology in public health. From honeybees to foodborne outbreaks, Brooke’s diverse research background offers listeners a fascinating journey through science, microbiology, and epidemiology. Key Points Research Focus on Staphylococcus aureus Investigated molecular epidemiology of MRSA (Methicillin-resistant Staphylococcus aureus) Explored USA 300 lineage and its emergence in the United States Studied genomic approaches to track bacterial strain evolution Antibiotic Resistance Dynamics Examined horizontal and de novo mutations in bacterial resistance Analyzed recurrence of bloodstream infections using genomic comparisons Highlighted challenges of tracking resistant bacterial strains Interdisciplinary Research Background Started with... Read more at https://happykhan.com/microbinfie/mb-134-diving-into-mrsa-genomics-and-public-health In this episode of the Micro Binfie Podcast, host Andrew Page speaks with Dr. Brooke Talbot, a recent PhD graduate from Emory University, about her research on Staphylococcus aureus, with a focus on MRSA and antibiotic resistance. Brooke shares insights into her molecular epidemiology work, discussing the complexities of tracking resistant bacterial strains in clinical settings and the significance of genomic epidemiology in public health. From honeybees to foodborne outbreaks, Brooke’s diverse research background offers listeners a fascinating journey through science, microbiology, and epidemiology. Key Points Research Focus on Staphylococcus aureus Investigated molecular epidemiology of MRSA (Methicillin-resistant Staphylococcus aureus) Explored USA 300 lineage and its emergence in the United States Studied genomic approaches to track bacterial strain evolution Antibiotic Resistance Dynamics Examined horizontal and de novo mutations in bacterial resistance Analyzed recurrence of bloodstream infections using genomic comparisons Highlighted challenges of tracking resistant bacterial strains Interdisciplinary Research Background Started with... Read more at https://happykhan.com/microbinfie/mb-134-diving-into-mrsa-genomics-and-public-health tag:soundcloud,2010:tracks/1933430264 https://soundcloud.com/microbinfie/133-public-health-insights-on-bioinformatics-from-utah Thu, 05 Dec 2024 14:00:01 GMT 00:12:36 Microbial Bioinformatics no In this episode of the Micro Binfie podcast, host… In this episode of the Micro Binfie podcast, host Andrew Page talks with Dr. Erin Young, a bioinformatician at the Utah Public Health Laboratory, recorded during the 10th Microbial Bioinformatics Hackathon in Bethesda, Maryland. Erin shares her journey from researching hereditary cancer predisposition to her current role in public health bioinformatics, which she entered through a prestigious CDC and APHL fellowship. The conversation delves into her work with bacterial pathogens, particularly in tracking antimicrobial resistance in organisms like Klebsiella. Erin discusses the tools she uses for genome typing, such as MASH, FastANI, and SKA, and her innovative research on the accuracy of long-read sequencing technologies like Nanopore for detecting antimicrobial resistance genes. She also provides a preview of her upcoming poster for ASM, where she examines how Nanopore reads can be used effectively in public health microbiology. This episode offers a fascinating look at how bioinformatics and genomics are advancing... Read more at https://happykhan.com/microbinfie/mb-133-the-role-of-bioinformatics-in-public-health-and-disease-outbreaks In this episode of the Micro Binfie podcast, host Andrew Page talks with Dr. Erin Young, a bioinformatician at the Utah Public Health Laboratory, recorded during the 10th Microbial Bioinformatics Hackathon in Bethesda, Maryland. Erin shares her journey from researching hereditary cancer predisposition to her current role in public health bioinformatics, which she entered through a prestigious CDC and APHL fellowship. The conversation delves into her work with bacterial pathogens, particularly in tracking antimicrobial resistance in organisms like Klebsiella. Erin discusses the tools she uses for genome typing, such as MASH, FastANI, and SKA, and her innovative research on the accuracy of long-read sequencing technologies like Nanopore for detecting antimicrobial resistance genes. She also provides a preview of her upcoming poster for ASM, where she examines how Nanopore reads can be used effectively in public health microbiology. This episode offers a fascinating look at how bioinformatics and genomics are advancing... Read more at https://happykhan.com/microbinfie/mb-133-the-role-of-bioinformatics-in-public-health-and-disease-outbreaks tag:soundcloud,2010:tracks/1933425278 https://soundcloud.com/microbinfie/132-unlocking-the-secrets-of-antimicrobial-resistance-in-metagenomes Thu, 21 Nov 2024 14:00:05 GMT 00:11:02 Microbial Bioinformatics no In this episode of the Micro Binfie podcast, host… In this episode of the Micro Binfie podcast, host Andrew Page is live from the 10th Microbial Bioinformatics Hackathon in Bethesda, Maryland. He sits down with David Mahoney, a PhD student from Dalhousie University in Halifax, Nova Scotia. David shares his research on characterizing antimicrobial resistance (AMR) genes and their transfer within metagenomes, focusing on metagenomic assembly graphs. They delve into David’s background in food safety microbiology and his interest in the public health implications of genomics. He explains his exciting work on analyzing how AMR genes transfer across different environments, such as food production plants and clinical settings, using both new and existing data from Canada’s Genomics Research and Development Initiative. David also highlights his use of innovative methods like assembly graphs and graph-based approaches to uncover AMR gene flow and lateral gene transfers, including the potential of machine learning techniques such as graph convolutional neural networks. Key Points... Read more at https://happykhan.com/microbinfie/mb-132-unlocking-the-secrets-of-antimicrobial-resistance-in-metagenomes In this episode of the Micro Binfie podcast, host Andrew Page is live from the 10th Microbial Bioinformatics Hackathon in Bethesda, Maryland. He sits down with David Mahoney, a PhD student from Dalhousie University in Halifax, Nova Scotia. David shares his research on characterizing antimicrobial resistance (AMR) genes and their transfer within metagenomes, focusing on metagenomic assembly graphs. They delve into David’s background in food safety microbiology and his interest in the public health implications of genomics. He explains his exciting work on analyzing how AMR genes transfer across different environments, such as food production plants and clinical settings, using both new and existing data from Canada’s Genomics Research and Development Initiative. David also highlights his use of innovative methods like assembly graphs and graph-based approaches to uncover AMR gene flow and lateral gene transfers, including the potential of machine learning techniques such as graph convolutional neural networks. Key Points... Read more at https://happykhan.com/microbinfie/mb-132-unlocking-the-secrets-of-antimicrobial-resistance-in-metagenomes tag:soundcloud,2010:tracks/1933421819 https://soundcloud.com/microbinfie/131-bioinformatics-evolution-torsten-seemann-on-snippy-open-source-support-and-global-genomics Thu, 07 Nov 2024 14:00:04 GMT 00:12:47 Microbial Bioinformatics no In this episode of the Micro Binfie Podcast, host… In this episode of the Micro Binfie Podcast, host Andrew Page catches up with Torsten Seemann at the 10th Microbial Bioinformatics Hackathon in Bethesda, Maryland. They discuss the rapid evolution of bioinformatics, the challenges faced by labs worldwide, and the explosion of tools post-COVID. Torsten shares insights into his work at Melbourne’s Microbiological Diagnostic Unit (MDU), the development of platforms like OzTracker for bacterial genomics, and how his lab plays a national and international role in data sharing. The conversation dives into the future of the widely-used variant calling tool Snippy, as Torsten reveals exciting updates funded by the Chan Zuckerberg Initiative, including nanopore read support and the ability to process pre-assembled genomes. They also explore the importance of maintaining open-source bioinformatics tools to prevent them from becoming obsolete. Tune in for an in-depth discussion on the state of genomics, software development, and the challenges and rewards of open-source collaboration.... Read more at https://happykhan.com/microbinfie/mb-131-bioinformatics-evolution-torsten-seemann-on-snippy-open-source-support-and-global-genomics In this episode of the Micro Binfie Podcast, host Andrew Page catches up with Torsten Seemann at the 10th Microbial Bioinformatics Hackathon in Bethesda, Maryland. They discuss the rapid evolution of bioinformatics, the challenges faced by labs worldwide, and the explosion of tools post-COVID. Torsten shares insights into his work at Melbourne’s Microbiological Diagnostic Unit (MDU), the development of platforms like OzTracker for bacterial genomics, and how his lab plays a national and international role in data sharing. The conversation dives into the future of the widely-used variant calling tool Snippy, as Torsten reveals exciting updates funded by the Chan Zuckerberg Initiative, including nanopore read support and the ability to process pre-assembled genomes. They also explore the importance of maintaining open-source bioinformatics tools to prevent them from becoming obsolete. Tune in for an in-depth discussion on the state of genomics, software development, and the challenges and rewards of open-source collaboration.... Read more at https://happykhan.com/microbinfie/mb-131-bioinformatics-evolution-torsten-seemann-on-snippy-open-source-support-and-global-genomics tag:soundcloud,2010:tracks/1933418207 https://soundcloud.com/microbinfie/130-exploring-genomic-innovation-and-machine-learning-in-public-health Fri, 25 Oct 2024 13:00:02 GMT 00:12:35 Microbial Bioinformatics no In this episode of the Micro binfie Podcast, host… In this episode of the Micro binfie Podcast, host Andrew Page sits down with Tim Dallman at the 10th Bioinformatics Hackathon in Bethesda, Maryland. Tim shares insights from his work at Utrecht University in the Netherlands, where he focuses on genomic surveillance and machine learning models to predict disease risk and severity. They discuss the challenges of integrating genomic variation into predictive models, the importance of high-quality metadata, and the complexities of working with pathogens like Shiga toxin-producing E. coli. Tim also talks about his role at the WHO Pandemic and Epidemic Intelligence Hub and how global collaboration can drive innovation in public health genomics. Tune in to hear about cutting- edge research, the importance of interdisciplinary teamwork, and how genomic data can be harnessed for future pandemic preparedness. Key Points Genomic Surveillance and Machine Learning Developing predictive models using pan-genome graphs Integrating genomic variation into machine learning approaches Focusing... Read more at https://happykhan.com/microbinfie/mb-130-exploring-genomic-innovation-and-machine-learning-in-public-health In this episode of the Micro binfie Podcast, host Andrew Page sits down with Tim Dallman at the 10th Bioinformatics Hackathon in Bethesda, Maryland. Tim shares insights from his work at Utrecht University in the Netherlands, where he focuses on genomic surveillance and machine learning models to predict disease risk and severity. They discuss the challenges of integrating genomic variation into predictive models, the importance of high-quality metadata, and the complexities of working with pathogens like Shiga toxin-producing E. coli. Tim also talks about his role at the WHO Pandemic and Epidemic Intelligence Hub and how global collaboration can drive innovation in public health genomics. Tune in to hear about cutting- edge research, the importance of interdisciplinary teamwork, and how genomic data can be harnessed for future pandemic preparedness. Key Points Genomic Surveillance and Machine Learning Developing predictive models using pan-genome graphs Integrating genomic variation into machine learning approaches Focusing... Read more at https://happykhan.com/microbinfie/mb-130-exploring-genomic-innovation-and-machine-learning-in-public-health tag:soundcloud,2010:tracks/1933410251 https://soundcloud.com/microbinfie/129-genomics-on-the-frontier-bactopia-bioinformatics-and-pathogen-surveillance-with-robert-petit Fri, 11 Oct 2024 18:36:18 GMT 00:14:58 Microbial Bioinformatics no Host Andrew Page is joined by Robert Petit from t… Host Andrew Page is joined by Robert Petit from the Wyoming Public Health Laboratory. Robert, a key developer of the Bactopia pipeline, shares insights into how this end-to-end tool is transforming bacterial genomic surveillance. They dive into the origins of Bactopia, its applications in public health, and Robert's experience leading genomic projects in a rural setting. Discover how Bactopia streamlines pathogen detection, improves documentation, and integrates with other tools to deliver fast and accurate results. Listen in as they discuss new innovations in bioinformatics, including visualizations and human-read filtering, and explore future projects like CamelHUMP, designed to simplify sequence-based typing. Recorded live at the Microbial Bioinformatics Hackathon in Bethesda, Maryland, this episode brings you the latest in pathogen genomics and the challenges and rewards of working on the frontier of public health. Key Points Bactopia Pipeline Development Originated from Staphopia project analyzing Staphylococcus genomes Provides rapid, comprehensive bacterial genome analysis... Read more at https://happykhan.com/microbinfie/mb-129-genomics-on-the-frontier-bactopia-bioinformatics-and-pathogen-surveillance-with-robert-petit Host Andrew Page is joined by Robert Petit from the Wyoming Public Health Laboratory. Robert, a key developer of the Bactopia pipeline, shares insights into how this end-to-end tool is transforming bacterial genomic surveillance. They dive into the origins of Bactopia, its applications in public health, and Robert's experience leading genomic projects in a rural setting. Discover how Bactopia streamlines pathogen detection, improves documentation, and integrates with other tools to deliver fast and accurate results. Listen in as they discuss new innovations in bioinformatics, including visualizations and human-read filtering, and explore future projects like CamelHUMP, designed to simplify sequence-based typing. Recorded live at the Microbial Bioinformatics Hackathon in Bethesda, Maryland, this episode brings you the latest in pathogen genomics and the challenges and rewards of working on the frontier of public health. Key Points Bactopia Pipeline Development Originated from Staphopia project analyzing Staphylococcus genomes Provides rapid, comprehensive bacterial genome analysis... Read more at https://happykhan.com/microbinfie/mb-129-genomics-on-the-frontier-bactopia-bioinformatics-and-pathogen-surveillance-with-robert-petit tag:soundcloud,2010:tracks/1898535225 https://soundcloud.com/microbinfie/128-haiti-cholera-outbreak-with-christine-lee-and-cynney-walters Thu, 19 Sep 2024 05:00:05 GMT 00:21:57 Microbial Bioinformatics no Andrew and Lee talk with Christine and Cynney abo… In this episode of the microbinfie podcast, experts from the CDC discuss the re-emergence of cholera in Haiti, highlighting the critical role of whole genome sequencing in tracking pathogen evolution and outbreak investigation. The discussion centered around the implications of the genome sequences study, highlighting the evolutionary dynamics of the strains and the public health strategies needed to control and prevent cholera outbreaks in Haiti. Key Points Haiti Cholera Outbreak Dynamics 2022 cholera outbreak followed environmental disruption from hurricanes Strains showed genetic similarity to 2010 outbreak isolates Genome sequencing revealed 0-25 single nucleotide polymorphisms between historical and new strains Vibrio cholerae has reemerged in Haiti in 2022. The outbreak reveals genetic similarities to strains that previously circulated in the region. We discussed Walters et al. "Genome sequences from a reemergence of Vibrio cholerae in Haiti, 2022 reveal relatedness to previously circulating strains" Genomic Surveillance Techniques Whole genome sequencing used to... Read more at https://happykhan.com/microbinfie/mb-128-haiti-cholera-outbreak-with-christine-lee-and-cynney-walters In this episode of the microbinfie podcast, experts from the CDC discuss the re-emergence of cholera in Haiti, highlighting the critical role of whole genome sequencing in tracking pathogen evolution and outbreak investigation. The discussion centered around the implications of the genome sequences study, highlighting the evolutionary dynamics of the strains and the public health strategies needed to control and prevent cholera outbreaks in Haiti. Key Points Haiti Cholera Outbreak Dynamics 2022 cholera outbreak followed environmental disruption from hurricanes Strains showed genetic similarity to 2010 outbreak isolates Genome sequencing revealed 0-25 single nucleotide polymorphisms between historical and new strains Vibrio cholerae has reemerged in Haiti in 2022. The outbreak reveals genetic similarities to strains that previously circulated in the region. We discussed Walters et al. "Genome sequences from a reemergence of Vibrio cholerae in Haiti, 2022 reveal relatedness to previously circulating strains" Genomic Surveillance Techniques Whole genome sequencing used to... Read more at https://happykhan.com/microbinfie/mb-128-haiti-cholera-outbreak-with-christine-lee-and-cynney-walters tag:soundcloud,2010:tracks/1897691619 https://soundcloud.com/microbinfie/127-minimum-spanning-trees Thu, 05 Sep 2024 05:00:08 GMT 00:15:49 Microbial Bioinformatics no Nabil and Lee have a quick chat about minimum spa… Nabil and Lee engage in a brief exchange about the concept of Minimum Spanning Trees (MST) in graph theory, which is crucial for optimizing network design. Definition of MST: - A Minimum Spanning Tree connects all vertices in a graph with the minimal total edge weight, without forming any cycles. Applications: - MSTs are used in various fields such as network design, clustering, and biology. Algorithms: - Popular algorithms for finding MSTs include Kruskal's and Prim's algorithms. - These algorithms are fundamental in computer science and operations research. For more in-depth information on related topics, consider exploring the Eburst paper By focusing on the efficiency and simplicity of minimum spanning trees, Lee and Nabil highlight the significance of these concepts in both theoretical studies and practical applications. Key Points Minimum Spanning Tree Fundamentals A graph theory concept that connects all vertices with minimal total edge weight Allows multiple node connections... Read more at https://happykhan.com/microbinfie/mb-127-minimum-spanning-trees Nabil and Lee engage in a brief exchange about the concept of Minimum Spanning Trees (MST) in graph theory, which is crucial for optimizing network design. Definition of MST: - A Minimum Spanning Tree connects all vertices in a graph with the minimal total edge weight, without forming any cycles. Applications: - MSTs are used in various fields such as network design, clustering, and biology. Algorithms: - Popular algorithms for finding MSTs include Kruskal's and Prim's algorithms. - These algorithms are fundamental in computer science and operations research. For more in-depth information on related topics, consider exploring the Eburst paper By focusing on the efficiency and simplicity of minimum spanning trees, Lee and Nabil highlight the significance of these concepts in both theoretical studies and practical applications. Key Points Minimum Spanning Tree Fundamentals A graph theory concept that connects all vertices with minimal total edge weight Allows multiple node connections... Read more at https://happykhan.com/microbinfie/mb-127-minimum-spanning-trees tag:soundcloud,2010:tracks/1897248948 https://soundcloud.com/microbinfie/126-tree-viz Thu, 22 Aug 2024 13:20:05 GMT 00:21:21 Microbial Bioinformatics no We go over tree visualizations! Tree visualizations help us understand complex branching structures and relationships in data, especially in the fields of biology and phylogenetics. Here are some popular tools and platforms used for creating and viewing tree visualizations: Microreact - Website: microreact.org - Microreact enables interactive visualization and sharing of phylogenetic trees and associated geographic, temporal, and other metadata. PhyloCanvas - Website: phylocanvas.gl - PhyloCanvas provides a versatile platform for rendering and interacting with biological trees in the browser. GrapeTree - GitHub: GrapeTree - GrapeTree is a tool for dynamic visualization of phylogenetic trees, particularly useful for analyzing bacterial genomes. Auspice/NextStrain - Website: nextstrain.org - Auspice is the visualization software used by NextStrain, providing real-time tracking of pathogen evolution. Taxonium - Website: taxonium.org - Taxonium offers powerful taxonomic tree visualization tools, optimized for handling extremely large datasets. iTOL: Interactive Tree Of Life - Website: itol.embl.de - iTOL is a web-based tool for the display,... Read more at https://happykhan.com/microbinfie/mb-126-tree-viz Tree visualizations help us understand complex branching structures and relationships in data, especially in the fields of biology and phylogenetics. Here are some popular tools and platforms used for creating and viewing tree visualizations: Microreact - Website: microreact.org - Microreact enables interactive visualization and sharing of phylogenetic trees and associated geographic, temporal, and other metadata. PhyloCanvas - Website: phylocanvas.gl - PhyloCanvas provides a versatile platform for rendering and interacting with biological trees in the browser. GrapeTree - GitHub: GrapeTree - GrapeTree is a tool for dynamic visualization of phylogenetic trees, particularly useful for analyzing bacterial genomes. Auspice/NextStrain - Website: nextstrain.org - Auspice is the visualization software used by NextStrain, providing real-time tracking of pathogen evolution. Taxonium - Website: taxonium.org - Taxonium offers powerful taxonomic tree visualization tools, optimized for handling extremely large datasets. iTOL: Interactive Tree Of Life - Website: itol.embl.de - iTOL is a web-based tool for the display,... Read more at https://happykhan.com/microbinfie/mb-126-tree-viz tag:soundcloud,2010:tracks/1826512452 https://soundcloud.com/microbinfie/kostas-konstantinidis-returns-to-talk-to-us-about-ani-and-metagenomics Thu, 06 Jun 2024 06:00:01 GMT 00:22:07 Microbial Bioinformatics no 125 Kostas Konstantinidis returns to talk to us a… In this session, Kostas Konstantinidis returns to discuss two important topics in microbial bioinformatics: Average Nucleotide Identity (ANI) and metagenomics. Average Nucleotide Identity (ANI) is a valuable tool for comparing genomic sequences. It serves as a crucial metric for species delineation and understanding the genetic relationships between different microorganisms. ANI provides insights into microbial taxonomy and genetic diversity by measuring the similarity between pairs of DNA sequences. Metagenomics involves the study of genetic material recovered directly from environmental samples. It enables the exploration of microbial communities without the need for cultivating individual species in the laboratory. This approach provides a comprehensive view of the biodiversity and functional potential of microbial ecosystems. Kostas Konstantinidis's insights into ANI and metagenomics deepen our understanding of microbial communities and their genetic diversity. These techniques play a significant role in advancing microbial bioinformatics and offer promising applications in various scientific fields. Extra notes Soil Metagenomics:... Read more at https://happykhan.com/microbinfie/mb-125-kostas-konstantinidis-returns-to-talk-to-us-about-ani-and-metagenomics In this session, Kostas Konstantinidis returns to discuss two important topics in microbial bioinformatics: Average Nucleotide Identity (ANI) and metagenomics. Average Nucleotide Identity (ANI) is a valuable tool for comparing genomic sequences. It serves as a crucial metric for species delineation and understanding the genetic relationships between different microorganisms. ANI provides insights into microbial taxonomy and genetic diversity by measuring the similarity between pairs of DNA sequences. Metagenomics involves the study of genetic material recovered directly from environmental samples. It enables the exploration of microbial communities without the need for cultivating individual species in the laboratory. This approach provides a comprehensive view of the biodiversity and functional potential of microbial ecosystems. Kostas Konstantinidis's insights into ANI and metagenomics deepen our understanding of microbial communities and their genetic diversity. These techniques play a significant role in advancing microbial bioinformatics and offer promising applications in various scientific fields. Extra notes Soil Metagenomics:... Read more at https://happykhan.com/microbinfie/mb-125-kostas-konstantinidis-returns-to-talk-to-us-about-ani-and-metagenomics tag:soundcloud,2010:tracks/1826512221 https://soundcloud.com/microbinfie/kostas-konstantinidis-talks-to-us-about-ani-and-metagenomics Thu, 23 May 2024 06:00:13 GMT 00:22:58 Microbial Bioinformatics no We talk with Kostas! For more information please … This podcast explores the evolving landscape of species identification, especially as genomic tools like ANI become central to understanding microbial diversity. For more information, please visit Konstantinidis lab website, enve-omics.gatech.edu. Here are the key points from the podcast introduction and initial conversation: Guest: Kostas Konstantinidis: - Background: Kostas is originally from Greece, with academic roots in agricultural sciences, and a PhD from Michigan State, working on microbial genomics. - Career Path: Transitioned from plant protection to studying soil microbiology, focusing on metagenomics and comparative genomics. This led to his involvement in developing Average Nucleotide Identity (ANI) for species delineation. - ANI Development: ANI emerged as a tool during his PhD to resolve the limitations of traditional methods (like 16S rRNA gene sequencing) in distinguishing closely related species. - Metagenomics Postdoc: Following his PhD, he did a postdoc with Ed DeLong at MIT, specializing in environmental metagenomics. ANI and Species Delineation:... Read more at https://happykhan.com/microbinfie/mb-124-kostas-konstantinidis-talks-to-us-about-ani-and-metagenomics This podcast explores the evolving landscape of species identification, especially as genomic tools like ANI become central to understanding microbial diversity. For more information, please visit Konstantinidis lab website, enve-omics.gatech.edu. Here are the key points from the podcast introduction and initial conversation: Guest: Kostas Konstantinidis: - Background: Kostas is originally from Greece, with academic roots in agricultural sciences, and a PhD from Michigan State, working on microbial genomics. - Career Path: Transitioned from plant protection to studying soil microbiology, focusing on metagenomics and comparative genomics. This led to his involvement in developing Average Nucleotide Identity (ANI) for species delineation. - ANI Development: ANI emerged as a tool during his PhD to resolve the limitations of traditional methods (like 16S rRNA gene sequencing) in distinguishing closely related species. - Metagenomics Postdoc: Following his PhD, he did a postdoc with Ed DeLong at MIT, specializing in environmental metagenomics. ANI and Species Delineation:... Read more at https://happykhan.com/microbinfie/mb-124-kostas-konstantinidis-talks-to-us-about-ani-and-metagenomics tag:soundcloud,2010:tracks/1770026592 https://soundcloud.com/microbinfie/123-hash-databases-for-cgmlst Thu, 21 Mar 2024 01:00:09 GMT 00:17:42 Microbial Bioinformatics no In this episode of the Micro Binfie Podcast, host… We explore the captivating world of hash databases and their usage in cgMLST (core genome Multilocus Sequence Typing) for microbial bioinformatics. Challenges with Siloed MLST Databases The episode begins by addressing the obstacles faced by bioinformaticians due to fragmented MLST databases worldwide. These silos impede synchronization and effective genomic surveillance. To overcome these challenges, the concept of using hash databases for allele identification is introduced. Hashing in Genomics Hashing is explained as a technique for creating unique identifiers for genetic sequences, which simplifies database synchronization without requiring extensive system support. Dr. Katz elaborates on the principles of hashing in genomics, noting how even a single nucleotide polymorphism (SNP) can generate a distinct hash, making it an ideal solution for differentiating alleles. Popular Hashing Algorithms The hosts discuss various hashing algorithms, such as MD5 and SHA-256, covering their benefits and the potential risks of hash collisions. They point out that employing... Read more at https://happykhan.com/microbinfie/mb-123-the-revolution-of-hash-databases-in-cgmlst We explore the captivating world of hash databases and their usage in cgMLST (core genome Multilocus Sequence Typing) for microbial bioinformatics. Challenges with Siloed MLST Databases The episode begins by addressing the obstacles faced by bioinformaticians due to fragmented MLST databases worldwide. These silos impede synchronization and effective genomic surveillance. To overcome these challenges, the concept of using hash databases for allele identification is introduced. Hashing in Genomics Hashing is explained as a technique for creating unique identifiers for genetic sequences, which simplifies database synchronization without requiring extensive system support. Dr. Katz elaborates on the principles of hashing in genomics, noting how even a single nucleotide polymorphism (SNP) can generate a distinct hash, making it an ideal solution for differentiating alleles. Popular Hashing Algorithms The hosts discuss various hashing algorithms, such as MD5 and SHA-256, covering their benefits and the potential risks of hash collisions. They point out that employing... Read more at https://happykhan.com/microbinfie/mb-123-the-revolution-of-hash-databases-in-cgmlst tag:soundcloud,2010:tracks/1770012039 https://soundcloud.com/microbinfie/gambit-genomic-approximation-method-for-bacterial-identification-and-tracking Sat, 09 Mar 2024 16:25:50 GMT 00:17:29 Microbial Bioinformatics no We discuss GAMBIT, software for accurately classi… GAMBIT (Genomic Approximation Method for Bacterial Identification and Tracking) is a sophisticated software solution designed for the precise classification of bacteria and eukaryotes. This software utilizes a targeted k-mer based approach to enhance the accuracy of such classifications. GAMBIT Software Repository: GitHub - gambit-suite/gambit GAMBIT Suite: GitHub - gambit-suite GAMBIT provides a methodology that rapidly exploits whole genome sequencing of bacterial isolates, facilitating their identification in clinical settings. For detailed insights into the working and efficacy of GAMBIT, refer to the research paper: "GAMBIT: A methodology to rapidly leverage whole genome sequencing of bacterial isolates for clinical identification" TheiaEuk is another tool available within the realm of bioinformatics. It serves as a species-agnostic workflow for the genomic characterization of fungi. To explore the functionalities and applications of TheiaEuk, see the full text of the article: "TheiaEuk: A species-agnostic bioinformatics workflow for fungal genomic characterization". These tools are pivotal in advancing... Read more at https://happykhan.com/microbinfie/mb-122-gambit-genomic-approximation-method-for-bacterial-identification-and-tracking GAMBIT (Genomic Approximation Method for Bacterial Identification and Tracking) is a sophisticated software solution designed for the precise classification of bacteria and eukaryotes. This software utilizes a targeted k-mer based approach to enhance the accuracy of such classifications. GAMBIT Software Repository: GitHub - gambit-suite/gambit GAMBIT Suite: GitHub - gambit-suite GAMBIT provides a methodology that rapidly exploits whole genome sequencing of bacterial isolates, facilitating their identification in clinical settings. For detailed insights into the working and efficacy of GAMBIT, refer to the research paper: "GAMBIT: A methodology to rapidly leverage whole genome sequencing of bacterial isolates for clinical identification" TheiaEuk is another tool available within the realm of bioinformatics. It serves as a species-agnostic workflow for the genomic characterization of fungi. To explore the functionalities and applications of TheiaEuk, see the full text of the article: "TheiaEuk: A species-agnostic bioinformatics workflow for fungal genomic characterization". These tools are pivotal in advancing... Read more at https://happykhan.com/microbinfie/mb-122-gambit-genomic-approximation-method-for-bacterial-identification-and-tracking tag:soundcloud,2010:tracks/1657196286 https://soundcloud.com/microbinfie/titus-2 Thu, 01 Feb 2024 05:00:02 GMT 00:20:03 Microbial Bioinformatics no In this episode, Andrew Page and Lee Katz continu… In this episode, Andrew Page and Lee Katz continue their conversation with Titus Brown, delving deeper into his work with k-mers, Sourmash, and open source software development. Topics Discussed K-mers for Analyzing Sequencing Data: The discussion focuses on how k-mers are used in sequencing data analysis and how Sourmash builds on the MinHash technique. Metagenomic Comparisons: A comparison between how Sourmash and MASH handle k-mers for metagenomic data. Technical Approaches: Explanation of the modhash and bottom sketch methods used in Sourmash to improve data handling. Noise and Error Management: Addressing how sequencing errors and noise in k-mer data are dealt with in Sourmash. Sourmash as a Reference-Based Method: Exploring the applications of Sourmash in metagenomics and how it functions as a reference-based method. Reusable Libraries and APIs: Titus discusses his focus on building reusable libraries and application programming interfaces, as opposed to creating single-use tools. Collaborator Recruitment: The concept of... Read more at https://happykhan.com/microbinfie/mb-121-k-mers-sourmash-and-open-source-software-more-conversations-with-titus-brown In this episode, Andrew Page and Lee Katz continue their conversation with Titus Brown, delving deeper into his work with k-mers, Sourmash, and open source software development. Topics Discussed K-mers for Analyzing Sequencing Data: The discussion focuses on how k-mers are used in sequencing data analysis and how Sourmash builds on the MinHash technique. Metagenomic Comparisons: A comparison between how Sourmash and MASH handle k-mers for metagenomic data. Technical Approaches: Explanation of the modhash and bottom sketch methods used in Sourmash to improve data handling. Noise and Error Management: Addressing how sequencing errors and noise in k-mer data are dealt with in Sourmash. Sourmash as a Reference-Based Method: Exploring the applications of Sourmash in metagenomics and how it functions as a reference-based method. Reusable Libraries and APIs: Titus discusses his focus on building reusable libraries and application programming interfaces, as opposed to creating single-use tools. Collaborator Recruitment: The concept of... Read more at https://happykhan.com/microbinfie/mb-121-k-mers-sourmash-and-open-source-software-more-conversations-with-titus-brown tag:soundcloud,2010:tracks/1657196586 https://soundcloud.com/microbinfie/titus-4 Thu, 18 Jan 2024 05:00:05 GMT 00:25:25 Microbial Bioinformatics no In this final episode with Titus Brown, the conve… In this final episode, our conversation with Titus Brown centers on his groundbreaking work in scaling metagenomic search using Sourmash. Here's an overview of the key topics discussed: Sourmash Overview Sketching and Comparing Large k-mer Datasets: Sourmash facilitates the representation and comparison of extensive k-mer datasets, essential for metagenomic analysis. Sampling Approach: This method enables innovative analyses, such as containment estimation, which allows researchers to determine the presence of sequence data within larger datasets. Branchwater and Scaling Branchwater Tool: The discussion highlights the exciting capabilities of the Branchwater tool for executing multi-threaded real-time searches of sequence read archives (SRA). Scaling with WebAssembly: Techniques leveraging WebAssembly allow for searching across millions of metagenomes in mere seconds, showcasing significant advancements in data retrieval speed and efficiency. Public Health Applications Pathogen Tracking and Sourcing: There is potential for using Sourmash in public health to track and identify the sources of pathogens swiftly. Caveats... Read more at https://happykhan.com/microbinfie/mb-120-scaling-metagenomic-search-with-sourmash-conversations-with-titus-brown In this final episode, our conversation with Titus Brown centers on his groundbreaking work in scaling metagenomic search using Sourmash. Here's an overview of the key topics discussed: Sourmash Overview Sketching and Comparing Large k-mer Datasets: Sourmash facilitates the representation and comparison of extensive k-mer datasets, essential for metagenomic analysis. Sampling Approach: This method enables innovative analyses, such as containment estimation, which allows researchers to determine the presence of sequence data within larger datasets. Branchwater and Scaling Branchwater Tool: The discussion highlights the exciting capabilities of the Branchwater tool for executing multi-threaded real-time searches of sequence read archives (SRA). Scaling with WebAssembly: Techniques leveraging WebAssembly allow for searching across millions of metagenomes in mere seconds, showcasing significant advancements in data retrieval speed and efficiency. Public Health Applications Pathogen Tracking and Sourcing: There is potential for using Sourmash in public health to track and identify the sources of pathogens swiftly. Caveats... Read more at https://happykhan.com/microbinfie/mb-120-scaling-metagenomic-search-with-sourmash-conversations-with-titus-brown tag:soundcloud,2010:tracks/1657196451 https://soundcloud.com/microbinfie/titus-3 Thu, 04 Jan 2024 05:00:09 GMT 00:22:53 Microbial Bioinformatics no In this episode, Andrew Page and Lee Katz continu… In this episode, Andrew Page and Lee Katz continue their discussion with Titus Brown, focusing on taxonomy assignment in metagenomics. The episode touches on several key topics: Dealing with Contamination and Low-Quality Genomes: In reference databases, managing contamination and genome quality is crucial for accurate taxonomy assignment. Sourmash as a Versatile Search Tool: Sourmash is highlighted as a flexible tool for searching, though it is not a curated database. High Confidence in Taxonomic Assignment for Public Health: The necessity of reliable taxonomic assignment is especially pressing in public health contexts. Challenges with Microbial Assignment Tools: Many microbial assignment tools exhibit low specificity or sensitivity, complicating accurate identification. Perfect Species Classification Theories: Potential strategies for achieving perfect species classification are explored, albeit mostly theoretical. Defining Species with Genomic Differences: The difficulties of defining species when only small genomic differences exist are discussed. Unicity Distance in Cryptography for Classification: An intriguing cryptographic... Read more at https://happykhan.com/microbinfie/mb-119-the-challenges-of-microbial-taxonomy-conversations-with-titus-brown In this episode, Andrew Page and Lee Katz continue their discussion with Titus Brown, focusing on taxonomy assignment in metagenomics. The episode touches on several key topics: Dealing with Contamination and Low-Quality Genomes: In reference databases, managing contamination and genome quality is crucial for accurate taxonomy assignment. Sourmash as a Versatile Search Tool: Sourmash is highlighted as a flexible tool for searching, though it is not a curated database. High Confidence in Taxonomic Assignment for Public Health: The necessity of reliable taxonomic assignment is especially pressing in public health contexts. Challenges with Microbial Assignment Tools: Many microbial assignment tools exhibit low specificity or sensitivity, complicating accurate identification. Perfect Species Classification Theories: Potential strategies for achieving perfect species classification are explored, albeit mostly theoretical. Defining Species with Genomic Differences: The difficulties of defining species when only small genomic differences exist are discussed. Unicity Distance in Cryptography for Classification: An intriguing cryptographic... Read more at https://happykhan.com/microbinfie/mb-119-the-challenges-of-microbial-taxonomy-conversations-with-titus-brown tag:soundcloud,2010:tracks/1685830371 https://soundcloud.com/microbinfie/real-bioinformaticians-react-to-jurassic-park Thu, 21 Dec 2023 07:00:00 GMT 01:00:44 Microbial Bioinformatics no Andrew, Nabil, and Lee react to the bioinformatic… In this episode, Andrew, Nabil, and Lee react to the depiction of bioinformatics and science as presented in the 1993 film Jurassic Park. We focused on several YouTube clips and additional resources as listed below: YouTube Clips Jurassic Park Clip 1 Jurassic Park Clip 2 Jurassic Park Clip 3 Jurassic Park Clip 4 Jurassic Park Clip 5 Additional Information For more insights into a specific narrative element of the film, such as Jeff Goldblum's character Dr. Ian Malcolm's secret tattoo, check out this detailed podcast episode: Jeff Goldblum’s Secret Tattoo in Jurassic Park. Discussion Points Bioinformatics Depictions: The film famously utilizes Deoxyribonucleic acid (DNA) sequencing as a central plot device. The way the movie envisions genetic engineering and biotechnology has sparked discussions regarding accuracy and creativity. Scientific Accuracy vs. Dramatic Effect: While Jurassic Park takes creative liberties, it also introduces complex scientific ideas like cloning and genetic splicing to a... Read more at https://happykhan.com/microbinfie/mb-118-real-bioinformaticians-react-to-jurassic-park In this episode, Andrew, Nabil, and Lee react to the depiction of bioinformatics and science as presented in the 1993 film Jurassic Park. We focused on several YouTube clips and additional resources as listed below: YouTube Clips Jurassic Park Clip 1 Jurassic Park Clip 2 Jurassic Park Clip 3 Jurassic Park Clip 4 Jurassic Park Clip 5 Additional Information For more insights into a specific narrative element of the film, such as Jeff Goldblum's character Dr. Ian Malcolm's secret tattoo, check out this detailed podcast episode: Jeff Goldblum’s Secret Tattoo in Jurassic Park. Discussion Points Bioinformatics Depictions: The film famously utilizes Deoxyribonucleic acid (DNA) sequencing as a central plot device. The way the movie envisions genetic engineering and biotechnology has sparked discussions regarding accuracy and creativity. Scientific Accuracy vs. Dramatic Effect: While Jurassic Park takes creative liberties, it also introduces complex scientific ideas like cloning and genetic splicing to a... Read more at https://happykhan.com/microbinfie/mb-118-real-bioinformaticians-react-to-jurassic-park tag:soundcloud,2010:tracks/1657196202 https://soundcloud.com/microbinfie/titus-brown-1 Thu, 07 Dec 2023 04:00:07 GMT 00:20:12 Microbial Bioinformatics no In this episode of the Micro Binfie Podcast, Andr… In this episode of the Micro Binfie Podcast, hosts Andrew Page and Lee Katz interview Titus Brown about his academic and professional journey. The discussion covers his transition from studying mathematics and physics as an undergraduate to becoming a bioinformatician, specializing in metagenomics and software development. Topics Discussed Titus' Background: - Initial studies in math and physics. - Research in digital evolution and developmental biology. Transition to Bioinformatics: - Entered bioinformatics to address the increasing influx of genomic data in the 1990s. Tool Development: - Creation of early tools for comparative genomics and sequence analysis. - Emphasizing the philosophy of developing user-friendly software with comprehensive documentation. Research Contributions: - Contributions to transcriptomics, metagenomics, and k-mers at Michigan State. - Innovations in digital normalization and handling large sequencing datasets. Career at UC Davis: - Continued work on metagenomics and software development, specifically tools like khmer and sourmash. Challenges in Science: -... Read more at https://happykhan.com/microbinfie/mb-117-from-math-to-metagenomics-titus-brown-on-career-journeys-and-software-solutions In this episode of the Micro Binfie Podcast, hosts Andrew Page and Lee Katz interview Titus Brown about his academic and professional journey. The discussion covers his transition from studying mathematics and physics as an undergraduate to becoming a bioinformatician, specializing in metagenomics and software development. Topics Discussed Titus' Background: - Initial studies in math and physics. - Research in digital evolution and developmental biology. Transition to Bioinformatics: - Entered bioinformatics to address the increasing influx of genomic data in the 1990s. Tool Development: - Creation of early tools for comparative genomics and sequence analysis. - Emphasizing the philosophy of developing user-friendly software with comprehensive documentation. Research Contributions: - Contributions to transcriptomics, metagenomics, and k-mers at Michigan State. - Innovations in digital normalization and handling large sequencing datasets. Career at UC Davis: - Continued work on metagenomics and software development, specifically tools like khmer and sourmash. Challenges in Science: -... Read more at https://happykhan.com/microbinfie/mb-117-from-math-to-metagenomics-titus-brown-on-career-journeys-and-software-solutions tag:soundcloud,2010:tracks/1656617619 https://soundcloud.com/microbinfie/116-ai-authorship-and-ethics-in-academic-publishing-for-genomics Thu, 23 Nov 2023 05:00:03 GMT 00:32:27 Microbial Bioinformatics no The podcast discusses an article co-authored by A… The podcast covers an article co-authored by Andrew Page, which examines the use of GPT-4 in research publications. The discussion focuses on the authorship of articles generated with GPT-4 and explores the implications for academic publishing. Key Topics Authorship and Ethics Andrew Page discusses the complexities of authorship when AI-generated content is involved in research articles. He addresses the ethical implications and potential biases associated with AI-assisted writing. Concerns include the omission of minority figures and novel discoveries. Andrew emphasizes the importance of transparency in AI's use, highlighting its potential to democratize research as long as ethical guidelines are observed. AI and Scientific Journals The podcast explores the current role of AI in academic publishing. The conversation touches on the commercial use of AI for crafting research manuscripts and the importance of differentiating between human and AI-generated contributions. Concerns are raised about the potential misalignment between GPT-4's commercial objectives and... Read more at https://happykhan.com/microbinfie/mb-116-ai-authorship-and-ethics-in-academic-publishing-for-genomics The podcast covers an article co-authored by Andrew Page, which examines the use of GPT-4 in research publications. The discussion focuses on the authorship of articles generated with GPT-4 and explores the implications for academic publishing. Key Topics Authorship and Ethics Andrew Page discusses the complexities of authorship when AI-generated content is involved in research articles. He addresses the ethical implications and potential biases associated with AI-assisted writing. Concerns include the omission of minority figures and novel discoveries. Andrew emphasizes the importance of transparency in AI's use, highlighting its potential to democratize research as long as ethical guidelines are observed. AI and Scientific Journals The podcast explores the current role of AI in academic publishing. The conversation touches on the commercial use of AI for crafting research manuscripts and the importance of differentiating between human and AI-generated contributions. Concerns are raised about the potential misalignment between GPT-4's commercial objectives and... Read more at https://happykhan.com/microbinfie/mb-116-ai-authorship-and-ethics-in-academic-publishing-for-genomics tag:soundcloud,2010:tracks/1656605382 https://soundcloud.com/microbinfie/write-the-speeding-up-software-development-for-bioinformatics Thu, 09 Nov 2023 05:00:16 GMT 00:24:22 Microbial Bioinformatics no We continue our conversation with Wytamma Wirth a… In our continuing conversation with Wytamma Wirth, we delve into the intersection of AI and coding, focusing on the use of language models like ChatGPT in programming. The discussion begins with how these models can streamline writing boilerplate code and how they assist in generating code snippets, unit tests, and even documentation strings. A significant focus is the integration of AI into code editors to enhance coding efficiency and reduce errors. Key Topics Discussed: Code Generation: AI tools, particularly ChatGPT, are highlighted for their capability to generate boilerplate code and assist with various coding tasks. Research Paper Automation: The conversation touches on how language models can aid in the generation of research papers, especially software announcements, by utilizing code documentation. AI's ability to draft introductions and background sections is considered valuable. Translation Utility: These models can also translate documentation into multiple languages, providing significant assistance to non-native English speakers. Documentation... Read more at https://happykhan.com/microbinfie/mb-115-write-the-speeding-up-software-development-for-bioinformatics In our continuing conversation with Wytamma Wirth, we delve into the intersection of AI and coding, focusing on the use of language models like ChatGPT in programming. The discussion begins with how these models can streamline writing boilerplate code and how they assist in generating code snippets, unit tests, and even documentation strings. A significant focus is the integration of AI into code editors to enhance coding efficiency and reduce errors. Key Topics Discussed: Code Generation: AI tools, particularly ChatGPT, are highlighted for their capability to generate boilerplate code and assist with various coding tasks. Research Paper Automation: The conversation touches on how language models can aid in the generation of research papers, especially software announcements, by utilizing code documentation. AI's ability to draft introductions and background sections is considered valuable. Translation Utility: These models can also translate documentation into multiple languages, providing significant assistance to non-native English speakers. Documentation... Read more at https://happykhan.com/microbinfie/mb-115-write-the-speeding-up-software-development-for-bioinformatics tag:soundcloud,2010:tracks/1656603129 https://soundcloud.com/microbinfie/write-the-automating-code-documentation-chatgpt Sat, 04 Nov 2023 11:01:20 GMT 00:25:35 Microbial Bioinformatics no In this episode, we dive deep into the world of a… In this episode, we dive deep into the world of automated code documentation and conversion using ChatGPT, powered by the Write-the software developed by Dr. Wytamma Wirth from the University of Melbourne. Our guest, an experienced software engineer, guides us through the challenges and nuances of writing code documentation and the role AI can play in streamlining this process. We explore the intersection of ChatGPT's capabilities with Write the Docs, a widely-used documentation system by developers. From showcasing ChatGPT's ability to understand and generate code snippets, to demonstrating real-time code conversion across multiple programming languages, this episode is a valuable resource for developers looking to enhance their workflow. Whether you're a seasoned developer or just getting started, tune in to discover how the synergy of AI and coding can elevate your documentation game to the next level! Links Write-the Software: GitHub Repository Wytamma Wirth: Personal Website Key Points Career Transition... Read more at https://happykhan.com/microbinfie/mb-114-write-the-automating-code-documentation-chatgpt In this episode, we dive deep into the world of automated code documentation and conversion using ChatGPT, powered by the Write-the software developed by Dr. Wytamma Wirth from the University of Melbourne. Our guest, an experienced software engineer, guides us through the challenges and nuances of writing code documentation and the role AI can play in streamlining this process. We explore the intersection of ChatGPT's capabilities with Write the Docs, a widely-used documentation system by developers. From showcasing ChatGPT's ability to understand and generate code snippets, to demonstrating real-time code conversion across multiple programming languages, this episode is a valuable resource for developers looking to enhance their workflow. Whether you're a seasoned developer or just getting started, tune in to discover how the synergy of AI and coding can elevate your documentation game to the next level! Links Write-the Software: GitHub Repository Wytamma Wirth: Personal Website Key Points Career Transition... Read more at https://happykhan.com/microbinfie/mb-114-write-the-automating-code-documentation-chatgpt tag:soundcloud,2010:tracks/1617965115 https://soundcloud.com/microbinfie/113-global-microbial-identifier-conference-with-ruth-timme Mon, 18 Sep 2023 05:00:18 GMT 00:08:11 Microbial Bioinformatics no Lee and Andrew are at the Global Microbial Identi… In this episode of the microbinfie podcast, the hosts discuss the Global Microbial Identifier (GMI) conference with Dr. Ruth Timme, exploring critical challenges in microbial genomics data submission and standardization. Location: Vancouver, Canada Day 3 Highlights: Catch up with Dr. Ruth Timme: Lee and Andrew engaged in insightful discussions with Dr. Ruth Timme, a prominent figure at the Global Microbial Identifier conference. The conference is focused on the latest advancements in microbiological research and technologies. Key Points Discussed: Microbial Genomics: Dr. Timme emphasized the importance of microbial genomics in understanding pathogen evolution and disease outbreaks. Metagenomics: The use of metagenomics was showcased as a powerful tool for studying microbial communities and their roles in various environments. Bioinformatics: Advances in bioinformatics are critical for processing large sequences of genomic data effectively. Collaboration and Networking: The conference provided an excellent platform for researchers and scientists to collaborate and foster new partnerships for... Read more at https://happykhan.com/microbinfie/mb-113-global-microbial-identifier-conference-with-ruth-timme In this episode of the microbinfie podcast, the hosts discuss the Global Microbial Identifier (GMI) conference with Dr. Ruth Timme, exploring critical challenges in microbial genomics data submission and standardization. Location: Vancouver, Canada Day 3 Highlights: Catch up with Dr. Ruth Timme: Lee and Andrew engaged in insightful discussions with Dr. Ruth Timme, a prominent figure at the Global Microbial Identifier conference. The conference is focused on the latest advancements in microbiological research and technologies. Key Points Discussed: Microbial Genomics: Dr. Timme emphasized the importance of microbial genomics in understanding pathogen evolution and disease outbreaks. Metagenomics: The use of metagenomics was showcased as a powerful tool for studying microbial communities and their roles in various environments. Bioinformatics: Advances in bioinformatics are critical for processing large sequences of genomic data effectively. Collaboration and Networking: The conference provided an excellent platform for researchers and scientists to collaborate and foster new partnerships for... Read more at https://happykhan.com/microbinfie/mb-113-global-microbial-identifier-conference-with-ruth-timme tag:soundcloud,2010:tracks/1617949095 https://soundcloud.com/microbinfie/112-global-microbial-identifier-conference-with-will-hsiao Sun, 17 Sep 2023 14:00:18 GMT 00:07:35 Microbial Bioinformatics no Andrew and Lee are at the Global Microbial Identi… Andrew and Lee are attending the Global Microbial Identifier conference (GMI13) in Vancouver, Canada. During the event, they had the opportunity to speak with Dr. William Hsiao, one of the conference's organizers. For updates from the conference and more detailed discussions, follow related content through official channels. Extra notes Microbial Bioinformatics: Key Points from Podcast Interoperability Focus: A significant component of the conference is on interoperability in bioinformatics. The aim is to use social perspectives to design technological solutions that gain better buy-in and promote equitable practices. Data Sharing and Social Sciences: The conference emphasizes enhancing data-sharing processes with social sciences to create a more equitable system rather than a one-size-fits-all approach. Equity and Diversity: An increased focus on equity and diversity is highlighted, particularly by involving low- and middle-income countries and marginalized communities like the First Nations. Critical Event Planning: Despite challenges such as event clashes (e.g., concurrent First... Read more at https://happykhan.com/microbinfie/mb-112-global-microbial-identifier-conference-with-will-hsiao Andrew and Lee are attending the Global Microbial Identifier conference (GMI13) in Vancouver, Canada. During the event, they had the opportunity to speak with Dr. William Hsiao, one of the conference's organizers. For updates from the conference and more detailed discussions, follow related content through official channels. Extra notes Microbial Bioinformatics: Key Points from Podcast Interoperability Focus: A significant component of the conference is on interoperability in bioinformatics. The aim is to use social perspectives to design technological solutions that gain better buy-in and promote equitable practices. Data Sharing and Social Sciences: The conference emphasizes enhancing data-sharing processes with social sciences to create a more equitable system rather than a one-size-fits-all approach. Equity and Diversity: An increased focus on equity and diversity is highlighted, particularly by involving low- and middle-income countries and marginalized communities like the First Nations. Critical Event Planning: Despite challenges such as event clashes (e.g., concurrent First... Read more at https://happykhan.com/microbinfie/mb-112-global-microbial-identifier-conference-with-will-hsiao tag:soundcloud,2010:tracks/1617932445 https://soundcloud.com/microbinfie/global-microbial-identifier-with-finlay-maguire-and-emma-griffiths Sat, 16 Sep 2023 14:53:39 GMT 00:21:08 Microbial Bioinformatics no Andrew and Lee are at the Global Microbial Identi… In this episode of the microbinfie podcast, host Andrew Page and Lee Katz explore microbial genomics and data sharing with guest Dr. Finlay Maguire at the Global Microbial Identifier Conference in Vancouver, Canada. Location: Vancouver, Canada Attendees: Andrew, Lee, Dr. Finlay Maguire, Dr. Emma Griffiths First Day Highlights Discussion Topics: - Microbial Genomics: An exploration of the advancements and current research in the field of microbial genomics. - Tim Hortons: A casual conversation about the popular Canadian coffee and donut franchise. Both Dr. Finlay Maguire and Dr. Emma Griffiths shared their insights into the world of microbial genomics, contributing to the broader dialogue on how these scientific advancements can impact global health. Extra notes Microbial Bioinformatics Background: The discussion features Finlay McGuire, an Assistant Professor at Dalhousie University with a background in microbiology, who currently specializes in pathogenomics and bioinformatics. He has affiliations in both Community Health and Epidemiology within... Read more at https://happykhan.com/microbinfie/mb-111-global-microbial-identifier-with-finlay-maguire-and-emma-griffiths In this episode of the microbinfie podcast, host Andrew Page and Lee Katz explore microbial genomics and data sharing with guest Dr. Finlay Maguire at the Global Microbial Identifier Conference in Vancouver, Canada. Location: Vancouver, Canada Attendees: Andrew, Lee, Dr. Finlay Maguire, Dr. Emma Griffiths First Day Highlights Discussion Topics: - Microbial Genomics: An exploration of the advancements and current research in the field of microbial genomics. - Tim Hortons: A casual conversation about the popular Canadian coffee and donut franchise. Both Dr. Finlay Maguire and Dr. Emma Griffiths shared their insights into the world of microbial genomics, contributing to the broader dialogue on how these scientific advancements can impact global health. Extra notes Microbial Bioinformatics Background: The discussion features Finlay McGuire, an Assistant Professor at Dalhousie University with a background in microbiology, who currently specializes in pathogenomics and bioinformatics. He has affiliations in both Community Health and Epidemiology within... Read more at https://happykhan.com/microbinfie/mb-111-global-microbial-identifier-with-finlay-maguire-and-emma-griffiths tag:soundcloud,2010:tracks/1555795549 https://soundcloud.com/microbinfie/chatgpt-the-bioinformatics-calculator Thu, 06 Jul 2023 04:00:15 GMT 00:26:47 Microbial Bioinformatics no In this episode there is a comprehensive discussi… In this episode there is a comprehensive discussion on the influence of AI, especially GPT-4, in the sphere of microbial bioinformatics. They reflect on a study testing GPT-4's problem-solving capabilities, which raises concerns about its potential impact on employment practices and academic integrity. There's speculation that AI's proficiency in tackling standard technical problems could interfere with genuinely evaluating a candidate's knowledge during interviews. Drawing parallels with calculators, the hosts deliberate on whether AI tools should be permitted during assessments. They stress the necessity for individuals to possess a deep understanding of their domain to accurately interpret and validate AI solutions. Discussing the AI's limitations, the hosts highlight its struggles with regular expressions and handling larger scripts. They observe the AI tends to loop and repeat itself, performing better with shorter scripts but faltering on more complex tasks often seen in bioinformatics. This prompts a discussion on how educators should address... Read more at https://happykhan.com/microbinfie/mb-110-chatgpt-the-bioinformatics-calculator In this episode there is a comprehensive discussion on the influence of AI, especially GPT-4, in the sphere of microbial bioinformatics. They reflect on a study testing GPT-4's problem-solving capabilities, which raises concerns about its potential impact on employment practices and academic integrity. There's speculation that AI's proficiency in tackling standard technical problems could interfere with genuinely evaluating a candidate's knowledge during interviews. Drawing parallels with calculators, the hosts deliberate on whether AI tools should be permitted during assessments. They stress the necessity for individuals to possess a deep understanding of their domain to accurately interpret and validate AI solutions. Discussing the AI's limitations, the hosts highlight its struggles with regular expressions and handling larger scripts. They observe the AI tends to loop and repeat itself, performing better with shorter scripts but faltering on more complex tasks often seen in bioinformatics. This prompts a discussion on how educators should address... Read more at https://happykhan.com/microbinfie/mb-110-chatgpt-the-bioinformatics-calculator tag:soundcloud,2010:tracks/1541726071 https://soundcloud.com/microbinfie/ai-unleashed-navigating-the-opportunities-and-challenges-of-ai-in-microbial-bioinformatics Thu, 22 Jun 2023 03:00:06 GMT 00:30:56 Microbial Bioinformatics no In this episode of the Micro Binfie Podcast, titl… The microbinfie podcast explores the transformative potential of AI tools like GPT in bioinformatics, highlighting their capabilities in code generation, task automation, and content creation while emphasizing the critical need for human verification. Key Points AI in Coding and Programming GitHub Copilot and GPT-4 can generate approximately 90% of correct code with minimal human input AI tools excel at creating boilerplate code, explaining complex scripts, and translating between programming languages Coding speed and efficiency can be significantly improved using AI-assisted programming AI Applications in Research and Documentation Potential for AI to draft academic papers, podcast scripts, and standardize data formats Ability to summarize research abstracts and generate technical documentation Useful for creating accessible content, particularly for individuals with visual impairments Challenges and Limitations of AI High risk of generating convincing but factually incorrect information Need for careful human verification and oversight of AI-generated content Potential for flooding information platforms with... Read more at https://happykhan.com/microbinfie/mb-109-ai-unleashed-navigating-the-opportunities-and-challenges-of-ai-in-microbial-bioinformatics The microbinfie podcast explores the transformative potential of AI tools like GPT in bioinformatics, highlighting their capabilities in code generation, task automation, and content creation while emphasizing the critical need for human verification. Key Points AI in Coding and Programming GitHub Copilot and GPT-4 can generate approximately 90% of correct code with minimal human input AI tools excel at creating boilerplate code, explaining complex scripts, and translating between programming languages Coding speed and efficiency can be significantly improved using AI-assisted programming AI Applications in Research and Documentation Potential for AI to draft academic papers, podcast scripts, and standardize data formats Ability to summarize research abstracts and generate technical documentation Useful for creating accessible content, particularly for individuals with visual impairments Challenges and Limitations of AI High risk of generating convincing but factually incorrect information Need for careful human verification and oversight of AI-generated content Potential for flooding information platforms with... Read more at https://happykhan.com/microbinfie/mb-109-ai-unleashed-navigating-the-opportunities-and-challenges-of-ai-in-microbial-bioinformatics tag:soundcloud,2010:tracks/1533198916 https://soundcloud.com/microbinfie/109-what-language-should-i-learn Thu, 08 Jun 2023 09:00:14 GMT 00:29:48 Microbial Bioinformatics no The MicroBinfie podcast discusses the top program… The MicroBinfie podcast discusses the top programming languages for bioinformatics. Andrew, Lee, and Nabil agree that Python is a great starting point for its consistency and rigor. Its strict syntax is ideal for teaching programming fundamentals that are essential in any language. In contrast, Perl encourages multiple ways of doing the same thing, creating confusion and difficulties in keeping track of things. The hosts caution against starting with trendy languages that are constantly changing. Instead, stick with more established languages like Python, which have established libraries and concepts that will help you advance more easily. Trendy languages come and go like changing tides, making them riskier choices. Additionally, they highlight the importance of understanding databases and their primary keys and unique fields. SQL is useful, particularly in dealing with large datasets. It is consistent across flavors and unlikely to go away soon. It takes a lot of skill to optimize... Read more at https://happykhan.com/microbinfie/mb-encore-what-language-should-i-learn The MicroBinfie podcast discusses the top programming languages for bioinformatics. Andrew, Lee, and Nabil agree that Python is a great starting point for its consistency and rigor. Its strict syntax is ideal for teaching programming fundamentals that are essential in any language. In contrast, Perl encourages multiple ways of doing the same thing, creating confusion and difficulties in keeping track of things. The hosts caution against starting with trendy languages that are constantly changing. Instead, stick with more established languages like Python, which have established libraries and concepts that will help you advance more easily. Trendy languages come and go like changing tides, making them riskier choices. Additionally, they highlight the importance of understanding databases and their primary keys and unique fields. SQL is useful, particularly in dealing with large datasets. It is consistent across flavors and unlikely to go away soon. It takes a lot of skill to optimize... Read more at https://happykhan.com/microbinfie/mb-encore-what-language-should-i-learn tag:soundcloud,2010:tracks/1407978727 https://soundcloud.com/microbinfie/seqcode-a-nomenclatural-code-for-prokaryotes-described-from-sequence-data Thu, 25 May 2023 04:00:08 GMT 00:45:59 Microbial Bioinformatics no We are back talking about systematics, and SeqCod… The microbinfie podcast explores SeqCode, a novel nomenclatural system for naming uncultivated prokaryotes using sequence data, representing a significant advancement in microbial taxonomy. Marike Palmer is a Postdoctoral researcher in the School of Life Sciences at the University of Nevada Las Vegas and Miguel Rodriguez is an Assistant Professor of Bioinformatics at the University of Innsbruck in the departments of Microbiology and the Digital Science Center (DiSC). Link to paper: https://www.nature.com/articles/s41564-022-01214-9 History paper: https://www.sciencedirect.com/science/article/pii/S0723202022000121 They discussed the SeqCode, a nomenclature code for Prokaryotes described from sequence data. The SeqCode was created to provide a specific nomenclature code for previously uncultivated organisms. Palmer explained that the impetus for the SeqCode was the need to accommodate previously uncultivated organisms under a specific nomenclature code. She emphasized that the SeqCode was written to allow any peer-reviewed publication, but noted that the authors have designed three paths of validation in the SeqCode. They hope... Read more at https://happykhan.com/microbinfie/mb-108-seqcode-a-nomenclatural-code-for-prokaryotes-described-from-sequence-data The microbinfie podcast explores SeqCode, a novel nomenclatural system for naming uncultivated prokaryotes using sequence data, representing a significant advancement in microbial taxonomy. Marike Palmer is a Postdoctoral researcher in the School of Life Sciences at the University of Nevada Las Vegas and Miguel Rodriguez is an Assistant Professor of Bioinformatics at the University of Innsbruck in the departments of Microbiology and the Digital Science Center (DiSC). Link to paper: https://www.nature.com/articles/s41564-022-01214-9 History paper: https://www.sciencedirect.com/science/article/pii/S0723202022000121 They discussed the SeqCode, a nomenclature code for Prokaryotes described from sequence data. The SeqCode was created to provide a specific nomenclature code for previously uncultivated organisms. Palmer explained that the impetus for the SeqCode was the need to accommodate previously uncultivated organisms under a specific nomenclature code. She emphasized that the SeqCode was written to allow any peer-reviewed publication, but noted that the authors have designed three paths of validation in the SeqCode. They hope... Read more at https://happykhan.com/microbinfie/mb-108-seqcode-a-nomenclatural-code-for-prokaryotes-described-from-sequence-data tag:soundcloud,2010:tracks/1407449647 https://soundcloud.com/microbinfie/nomenclature-systematics-and-taxonomy Thu, 11 May 2023 04:00:00 GMT 00:33:16 Microbial Bioinformatics no Today we are talking about systematics, and speci… The microbinfie podcast explores systematics and nomenclature in microbial classification, focusing on SeqCode, a novel approach to naming prokaryotes using genomic sequence data. We are joined by co-authors of the recent publication on this topic: Marike Palmer: Postdoctoral researcher in the School of Life Sciences at the University of Nevada, Las Vegas. Miguel Rodriguez: Assistant Professor of Bioinformatics at the University of Innsbruck, specializing in the Department of Microbiology and the Digital Science Center (DiSC). SeqCode represents a significant development in the classification and naming of prokaryotes based on sequence data, offering a modern approach to microbial taxonomy. Key Points Systematics and Nomenclature Systematics involves classification and naming of biological organisms Taxonomy differs from nomenclature, with nomenclature focusing on naming rules Stable naming is crucial for scientific communication SeqCode Challenges Previous nomenclature systems required physical bacterial cultures for naming Candidatus naming lacked regulation and created naming inconsistencies Genome sequences can... Read more at https://happykhan.com/microbinfie/mb-107-systematics-and-naming-of-prokaryotes-in-the-era-of-sequencing The microbinfie podcast explores systematics and nomenclature in microbial classification, focusing on SeqCode, a novel approach to naming prokaryotes using genomic sequence data. We are joined by co-authors of the recent publication on this topic: Marike Palmer: Postdoctoral researcher in the School of Life Sciences at the University of Nevada, Las Vegas. Miguel Rodriguez: Assistant Professor of Bioinformatics at the University of Innsbruck, specializing in the Department of Microbiology and the Digital Science Center (DiSC). SeqCode represents a significant development in the classification and naming of prokaryotes based on sequence data, offering a modern approach to microbial taxonomy. Key Points Systematics and Nomenclature Systematics involves classification and naming of biological organisms Taxonomy differs from nomenclature, with nomenclature focusing on naming rules Stable naming is crucial for scientific communication SeqCode Challenges Previous nomenclature systems required physical bacterial cultures for naming Candidatus naming lacked regulation and created naming inconsistencies Genome sequences can... Read more at https://happykhan.com/microbinfie/mb-107-systematics-and-naming-of-prokaryotes-in-the-era-of-sequencing tag:soundcloud,2010:tracks/1394785387 https://soundcloud.com/microbinfie/research-careers-discussion-with-postdoc-panel Thu, 27 Apr 2023 04:00:07 GMT 00:15:19 Microbial Bioinformatics no An honest discussion about the up and downsides o… This episode explores the motivations, challenges, and rewards of pursuing a postdoctoral research career through candid discussions with experienced scientists. Panelists: Dr. Emma Waters, Dr. Heather Felgate, Dr. Muhammad Yasir, Dr. Andrew Page Event: Microbes, Microbiomes and Bioinformatics Doctoral Training Program Location: Quadram Institute, Norwich, UK The discussion started with Dr. Emma Waters expressing her enthusiasm for research, highlighting the joy she finds in problem-solving and utilizing various tools. She emphasized her love for the thrill of discovery and exploration that a postdoc position offers. Dr. Heather Felgate shared similar sentiments, stating that she is content with her current position rather than pursuing higher-paying industry jobs. She values the flexibility that academia provides, allowing her to effectively balance her professional and personal life. As the conversation progressed, the PhD students posed questions regarding whether the postdocs ever regretted choosing academia, especially given the noticeable pay gap between academia and industry.... Read more at https://happykhan.com/microbinfie/mb-106-why-on-earth-would-you-do-a-postdoc This episode explores the motivations, challenges, and rewards of pursuing a postdoctoral research career through candid discussions with experienced scientists. Panelists: Dr. Emma Waters, Dr. Heather Felgate, Dr. Muhammad Yasir, Dr. Andrew Page Event: Microbes, Microbiomes and Bioinformatics Doctoral Training Program Location: Quadram Institute, Norwich, UK The discussion started with Dr. Emma Waters expressing her enthusiasm for research, highlighting the joy she finds in problem-solving and utilizing various tools. She emphasized her love for the thrill of discovery and exploration that a postdoc position offers. Dr. Heather Felgate shared similar sentiments, stating that she is content with her current position rather than pursuing higher-paying industry jobs. She values the flexibility that academia provides, allowing her to effectively balance her professional and personal life. As the conversation progressed, the PhD students posed questions regarding whether the postdocs ever regretted choosing academia, especially given the noticeable pay gap between academia and industry.... Read more at https://happykhan.com/microbinfie/mb-106-why-on-earth-would-you-do-a-postdoc tag:soundcloud,2010:tracks/1394764666 https://soundcloud.com/microbinfie/mobile-genetic-elements-panel Thu, 20 Apr 2023 04:00:06 GMT 00:43:54 Microbial Bioinformatics no This is a panel discussion on mobile genetic elem… This episode explores the complex world of mobile genetic elements, antimicrobial resistance, and bacterial genomics through expert panel discussions featuring researchers from the Quadram Institute. Guest Chair: Dr. Muhammad Yasir Guests: Dr. Emma Waters, Dr. Heather Felgate, Dr. Andrew Page Topics Covered Antimicrobial Resistance (AMR) Salmonella Typhi Staphylococci Outbreaks and the Role of Mobile Genetic Elements (MGEs) This panel discussion was recorded in front of a live audience of PhD students at the Microbes, Microbiomes, and Bioinformatics doctoral training program at the Quadram Institute in Norwich, UK. Key Points Antimicrobial Resistance in Salmonella Typhi Discovered extremely drug-resistant (XDR) typhoid strain in Pakistan Identified plasmid transfers between bacterial species contributing to resistance Research led to WHO vaccination program implementation Mobile Genetic Elements in Bacteria Multiple types exist including phages, transposons, and plasmids Can transfer between different bacterial species Require comprehensive genomic and phenotypic investigation Challenges in Antibiotic Resistance Detection Not all... Read more at https://happykhan.com/microbinfie/mb-105-mobile-genetic-elements-panel-discussion This episode explores the complex world of mobile genetic elements, antimicrobial resistance, and bacterial genomics through expert panel discussions featuring researchers from the Quadram Institute. Guest Chair: Dr. Muhammad Yasir Guests: Dr. Emma Waters, Dr. Heather Felgate, Dr. Andrew Page Topics Covered Antimicrobial Resistance (AMR) Salmonella Typhi Staphylococci Outbreaks and the Role of Mobile Genetic Elements (MGEs) This panel discussion was recorded in front of a live audience of PhD students at the Microbes, Microbiomes, and Bioinformatics doctoral training program at the Quadram Institute in Norwich, UK. Key Points Antimicrobial Resistance in Salmonella Typhi Discovered extremely drug-resistant (XDR) typhoid strain in Pakistan Identified plasmid transfers between bacterial species contributing to resistance Research led to WHO vaccination program implementation Mobile Genetic Elements in Bacteria Multiple types exist including phages, transposons, and plasmids Can transfer between different bacterial species Require comprehensive genomic and phenotypic investigation Challenges in Antibiotic Resistance Detection Not all... Read more at https://happykhan.com/microbinfie/mb-105-mobile-genetic-elements-panel-discussion tag:soundcloud,2010:tracks/1407306292 https://soundcloud.com/microbinfie/the-kraken-software-suite Thu, 06 Apr 2023 04:00:07 GMT 00:21:50 Microbial Bioinformatics no We talk about KRAKEN the taxonomic classification… This episode explores the Kraken software suite, a powerful taxonomic classification tool used for metagenomic analysis and pathogen detection. Experts from Johns Hopkins University discuss the evolution of Kraken and its various versions, highlighting its significance in bioinformatics research. Kraken Versions and Features The discussion began with an overview of the original Kraken, which employs an exact k-mer matching process. Interestingly, the design is inspired by jellyfish, using a k-mer size of 31. Kraken Unique is a variant that introduces a unique k-mer counting column, allowing users to determine how many unique k-mers are covered by each read. This provides an additional method for verifying microbial identification. Kraken 2 Kraken 2 was created to handle larger databases efficiently. It does so by using a probabilistic data structure and minimizers, which help map k-mers to shorter sequence sizes. This advancement enables more robust analyses, particularly useful in microbiome research and pathogen... Read more at https://happykhan.com/microbinfie/mb-104-the-kraken-software-suite This episode explores the Kraken software suite, a powerful taxonomic classification tool used for metagenomic analysis and pathogen detection. Experts from Johns Hopkins University discuss the evolution of Kraken and its various versions, highlighting its significance in bioinformatics research. Kraken Versions and Features The discussion began with an overview of the original Kraken, which employs an exact k-mer matching process. Interestingly, the design is inspired by jellyfish, using a k-mer size of 31. Kraken Unique is a variant that introduces a unique k-mer counting column, allowing users to determine how many unique k-mers are covered by each read. This provides an additional method for verifying microbial identification. Kraken 2 Kraken 2 was created to handle larger databases efficiently. It does so by using a probabilistic data structure and minimizers, which help map k-mers to shorter sequence sizes. This advancement enables more robust analyses, particularly useful in microbiome research and pathogen... Read more at https://happykhan.com/microbinfie/mb-104-the-kraken-software-suite tag:soundcloud,2010:tracks/1406671645 https://soundcloud.com/microbinfie/release-the-kraken Thu, 23 Mar 2023 05:00:08 GMT 00:27:09 Microbial Bioinformatics no We are talking about KRAKEN - the taxonomic class… The MicroBinfie podcast recently welcomed Dr. Jennifer Lu and Natalia Rincon to discuss Kraken, a cutting-edge taxonomic classification software. Developed between 2013-2014, Kraken excels at identifying and assigning sequencing reads to specific species, genera, or general bacterial groups. Its ability to efficiently classify millions or even billions of reads sets it apart from other methods like Melan, MegaBlast, and Chime. Known for its accuracy and user-friendliness, Kraken has become a preferred tool in metagenomic analysis. Evolution of Kraken Following Kraken's initial success, Florian Breitweiser developed Kraken Unique, an iteration that provides more comprehensive information than the standard version. Another important addition to the Kraken suite is Bracken, created by Dr. Jennifer Lu, which estimates abundance. Natalia Rincon's contributions focus on the newest iterations that analyze diversity metrics. The Kraken family continues to evolve with precise camera-matching technology, classifying taxonomy IDs and generating two main outputs: a detailed text file for... Read more at https://happykhan.com/microbinfie/mb-103-release-the-kraken The MicroBinfie podcast recently welcomed Dr. Jennifer Lu and Natalia Rincon to discuss Kraken, a cutting-edge taxonomic classification software. Developed between 2013-2014, Kraken excels at identifying and assigning sequencing reads to specific species, genera, or general bacterial groups. Its ability to efficiently classify millions or even billions of reads sets it apart from other methods like Melan, MegaBlast, and Chime. Known for its accuracy and user-friendliness, Kraken has become a preferred tool in metagenomic analysis. Evolution of Kraken Following Kraken's initial success, Florian Breitweiser developed Kraken Unique, an iteration that provides more comprehensive information than the standard version. Another important addition to the Kraken suite is Bracken, created by Dr. Jennifer Lu, which estimates abundance. Natalia Rincon's contributions focus on the newest iterations that analyze diversity metrics. The Kraken family continues to evolve with precise camera-matching technology, classifying taxonomy IDs and generating two main outputs: a detailed text file for... Read more at https://happykhan.com/microbinfie/mb-103-release-the-kraken tag:soundcloud,2010:tracks/1406586625 https://soundcloud.com/microbinfie/early-days-of-mlst Thu, 09 Mar 2023 05:00:08 GMT 00:40:15 Microbial Bioinformatics no Ed Feil is a professor of bacterial evolution at … The microbinfie podcast delves into the history and significance of Multi-Locus Sequence Typing (MLST), a pivotal method for bacterial strain identification and population genetics research. In this session, we explore the concept of multi-locus sequence typing (MLST) in bacterial population genetics with insights from our esteemed guests. What is MLST? MLST is a method utilized to define bacterial strains based on partial sequences that can be up to 500 base pairs long. This method identifies differences between loci for each strain and assigns an allele number, providing identical sequences with the same numbers. The cumulative sequence number generated is known as the sequence type (SST), which is used for unique identification. Significance of MLST MLST has transformed the study of bacterial genetics by enabling digital storage and comparison of epidemiological databases. Its applications are particularly valuable in: Investigating transmission events Tracking the dissemination of specific strains Although there are methods... Read more at https://happykhan.com/microbinfie/mb-102-early-days-of-mlst The microbinfie podcast delves into the history and significance of Multi-Locus Sequence Typing (MLST), a pivotal method for bacterial strain identification and population genetics research. In this session, we explore the concept of multi-locus sequence typing (MLST) in bacterial population genetics with insights from our esteemed guests. What is MLST? MLST is a method utilized to define bacterial strains based on partial sequences that can be up to 500 base pairs long. This method identifies differences between loci for each strain and assigns an allele number, providing identical sequences with the same numbers. The cumulative sequence number generated is known as the sequence type (SST), which is used for unique identification. Significance of MLST MLST has transformed the study of bacterial genetics by enabling digital storage and comparison of epidemiological databases. Its applications are particularly valuable in: Investigating transmission events Tracking the dissemination of specific strains Although there are methods... Read more at https://happykhan.com/microbinfie/mb-102-early-days-of-mlst tag:soundcloud,2010:tracks/1406448652 https://soundcloud.com/microbinfie/one-health Thu, 23 Feb 2023 05:00:07 GMT 00:36:29 Microbial Bioinformatics no The hosts of the MicroBinfie podcast invite Dr Na… The microbinfie podcast delves into the complex One Health framework with experts Dr. Natacha Couto and Professor Ed Feil, exploring the interconnected dynamics of antimicrobial resistance (AMR) across human, animal, and environmental sectors. The discussion critically examines the traditional visual representations of disease transmission and highlights the nuanced challenges in understanding ecological and biological barriers. Misleading Visuals in One Health During the discussion, the guests noted that diagrams often used to represent One Health can be misleading; they frequently do not account for the complexity of AMR transmission. This suggests a need for a quantitative study to understand and identify the ecological and biological barriers to AMR transmission. While visual aids like diagrams can be helpful, they are not always accurate and should be approached with caution, given the implicit confirmation bias in visually appealing graphics. AMR Determinants AMR determinants are found in various settings, including animals, the environment, and... Read more at https://happykhan.com/microbinfie/mb-101-one-health-with-natacha-couto-and-ed-feil The microbinfie podcast delves into the complex One Health framework with experts Dr. Natacha Couto and Professor Ed Feil, exploring the interconnected dynamics of antimicrobial resistance (AMR) across human, animal, and environmental sectors. The discussion critically examines the traditional visual representations of disease transmission and highlights the nuanced challenges in understanding ecological and biological barriers. Misleading Visuals in One Health During the discussion, the guests noted that diagrams often used to represent One Health can be misleading; they frequently do not account for the complexity of AMR transmission. This suggests a need for a quantitative study to understand and identify the ecological and biological barriers to AMR transmission. While visual aids like diagrams can be helpful, they are not always accurate and should be approached with caution, given the implicit confirmation bias in visually appealing graphics. AMR Determinants AMR determinants are found in various settings, including animals, the environment, and... Read more at https://happykhan.com/microbinfie/mb-101-one-health-with-natacha-couto-and-ed-feil tag:soundcloud,2010:tracks/1433179039 https://soundcloud.com/microbinfie/100th-episode Thu, 09 Feb 2023 06:00:05 GMT 00:52:26 Microbial Bioinformatics no We celebrate having 100 episodes! We look back a… In this special episode, we celebrate reaching the milestone of 100 episodes! We reflect on the fascinating journey of our podcast, discussing its history and exploring what the future might hold. Highlights History Review: We take a nostalgic look back at the origins and evolution of our podcast, revisiting some memorable episodes and moments. Future Prospects: Our discussion turns to the future, where we share our hopes, plans, and what listeners might expect in the episodes to come. Special Segment: Local Word Challenge As a fun twist, Lee gets his revenge by challenging Andrew and Nabil to pronounce words that are local to his region. Listen in for some humorous attempts and learning moments. Mentioned Resources Scientific Paper: During the episode, we very briefly mention a fascinating scientific paper titled "A phage therapy CDR-h3 epitope dataset" published in Nature. You can read more about it here. Phage Database: Nabil recalled... Read more at https://happykhan.com/microbinfie/mb-100-the-100th-episode In this special episode, we celebrate reaching the milestone of 100 episodes! We reflect on the fascinating journey of our podcast, discussing its history and exploring what the future might hold. Highlights History Review: We take a nostalgic look back at the origins and evolution of our podcast, revisiting some memorable episodes and moments. Future Prospects: Our discussion turns to the future, where we share our hopes, plans, and what listeners might expect in the episodes to come. Special Segment: Local Word Challenge As a fun twist, Lee gets his revenge by challenging Andrew and Nabil to pronounce words that are local to his region. Listen in for some humorous attempts and learning moments. Mentioned Resources Scientific Paper: During the episode, we very briefly mention a fascinating scientific paper titled "A phage therapy CDR-h3 epitope dataset" published in Nature. You can read more about it here. Phage Database: Nabil recalled... Read more at https://happykhan.com/microbinfie/mb-100-the-100th-episode tag:soundcloud,2010:tracks/1405781155 https://soundcloud.com/microbinfie/99-stories-from-the-frontlines-of-bioinformatics Thu, 26 Jan 2023 05:00:08 GMT 00:39:07 Microbial Bioinformatics no At the 8th Microbial Bioinformatics Hackathon in … In this candid episode of the microbinfie podcast, guests share real-world challenges and humorous anecdotes from bioinformatics work, focusing on data management, processing complexities, and pandemic-era research experiences. At the 8th Microbial Bioinformatics Hackathon in Bath, we had the opportunity to engage with a live panel featuring Kristy Horan, Torsten Seemann, Finlay Maguire, and Andrew Page. The discussion focused on bioinformatics from the frontlines. Note: We apologize for the poor audio quality. The recording took place in a room with approximately 20 people in the background, which occasionally made the audio slightly loud. However, we hope you still enjoy the insightful discussion. Key Points Data Wrangling Challenges Parsing metadata from PDF documents is a common and frustrating task Excel's automatic data type conversion can introduce significant errors Hospital and patient ID systems often lack consistency and global uniqueness COVID-19 Research Insights Pandemic research revealed massive logistical and computational challenges Sequencing... Read more at https://happykhan.com/microbinfie/mb-99-stories-from-the-frontlines-of-bioinformatics In this candid episode of the microbinfie podcast, guests share real-world challenges and humorous anecdotes from bioinformatics work, focusing on data management, processing complexities, and pandemic-era research experiences. At the 8th Microbial Bioinformatics Hackathon in Bath, we had the opportunity to engage with a live panel featuring Kristy Horan, Torsten Seemann, Finlay Maguire, and Andrew Page. The discussion focused on bioinformatics from the frontlines. Note: We apologize for the poor audio quality. The recording took place in a room with approximately 20 people in the background, which occasionally made the audio slightly loud. However, we hope you still enjoy the insightful discussion. Key Points Data Wrangling Challenges Parsing metadata from PDF documents is a common and frustrating task Excel's automatic data type conversion can introduce significant errors Hospital and patient ID systems often lack consistency and global uniqueness COVID-19 Research Insights Pandemic research revealed massive logistical and computational challenges Sequencing... Read more at https://happykhan.com/microbinfie/mb-99-stories-from-the-frontlines-of-bioinformatics tag:soundcloud,2010:tracks/1369813465 https://soundcloud.com/microbinfie/nomadic-bioinformatics-with-frank Thu, 12 Jan 2023 10:00:01 GMT 00:42:39 Microbial Bioinformatics no We interview Frank Ambrosio. He is embarking on … In a recent episode of the MicroBinfie podcast, we had the pleasure of interviewing Frank Ambrosio, a bioinformatician working with Theiagen as a traveling bioinformatician. Join hosts Andrew, Nabil and Lee as they dive into Frank's journey from a lab technician and microbiologist to a role where he analyzes his data and pursues a master's in bioinformatics at Georgia Tech. Frank shares insights from his tenure at the CDC, where he gained exposure to a variety of laboratories, including those focused on tuberculosis, biodefense research and development, surveillance-oriented production laboratories for Streptococcus genomes, and the division of HIV/AIDS prevention. For those aspiring to enter the field, Frank recommends applying through contracting agencies at the CDC to gain valuable experience and possibly secure full-time positions. He also suggests starting with a virtual machine and using cloud-based IDEs like Google Cloud and VS Code for their ease of use and reliability. The... Read more at https://happykhan.com/microbinfie/mb-98-nomadic-bioinformatics-with-frank In a recent episode of the MicroBinfie podcast, we had the pleasure of interviewing Frank Ambrosio, a bioinformatician working with Theiagen as a traveling bioinformatician. Join hosts Andrew, Nabil and Lee as they dive into Frank's journey from a lab technician and microbiologist to a role where he analyzes his data and pursues a master's in bioinformatics at Georgia Tech. Frank shares insights from his tenure at the CDC, where he gained exposure to a variety of laboratories, including those focused on tuberculosis, biodefense research and development, surveillance-oriented production laboratories for Streptococcus genomes, and the division of HIV/AIDS prevention. For those aspiring to enter the field, Frank recommends applying through contracting agencies at the CDC to gain valuable experience and possibly secure full-time positions. He also suggests starting with a virtual machine and using cloud-based IDEs like Google Cloud and VS Code for their ease of use and reliability. The... Read more at https://happykhan.com/microbinfie/mb-98-nomadic-bioinformatics-with-frank tag:soundcloud,2010:tracks/1405848646 https://soundcloud.com/microbinfie/advances-in-sequencing-technologies Thu, 29 Dec 2022 05:00:07 GMT 00:17:12 Microbial Bioinformatics no We discuss recent advancements in genome sequenci… The microbinfie podcast explores cutting-edge research in microbial genomics, focusing on mobile genetic elements, antibiotic resistance, and genome sequencing technologies through expert discussions and case studies. Key Points Antibiotic Resistance Mechanisms Detailed investigation of extremely drug-resistant (XDR) Salmonella typhi in Pakistan Tracking mobile genetic element transfer between bacterial species Importance of combining phenotypic and genomic approaches in resistance studies Mobile Genetic Elements Exploration of various mobile genetic elements like phages, transposons, and plasmids Complexity of gene transfer between bacterial species Challenges in identifying and understanding genetic mobility Genomic Research Techniques Advanced sequencing methods for tracking bacterial evolution Importance of comprehensive genomic and phenotypic analysis Difficulties in correlating genetic markers with actual resistance Take-Home Messages Antibiotic resistance is a complex, multifaceted challenge requiring interdisciplinary research Genomic techniques provide unprecedented insights into bacterial evolution Understanding mobile genetic elements is crucial for tracking disease transmission The microbinfie podcast explores cutting-edge research in microbial genomics, focusing on mobile genetic elements, antibiotic resistance, and genome sequencing technologies through expert discussions and case studies. Key Points Antibiotic Resistance Mechanisms Detailed investigation of extremely drug-resistant (XDR) Salmonella typhi in Pakistan Tracking mobile genetic element transfer between bacterial species Importance of combining phenotypic and genomic approaches in resistance studies Mobile Genetic Elements Exploration of various mobile genetic elements like phages, transposons, and plasmids Complexity of gene transfer between bacterial species Challenges in identifying and understanding genetic mobility Genomic Research Techniques Advanced sequencing methods for tracking bacterial evolution Importance of comprehensive genomic and phenotypic analysis Difficulties in correlating genetic markers with actual resistance Take-Home Messages Antibiotic resistance is a complex, multifaceted challenge requiring interdisciplinary research Genomic techniques provide unprecedented insights into bacterial evolution Understanding mobile genetic elements is crucial for tracking disease transmission tag:soundcloud,2010:tracks/1405835830 https://soundcloud.com/microbinfie/immem-xiii-and-asm-ngs Thu, 22 Dec 2022 10:33:54 GMT 00:35:34 Microbial Bioinformatics no We've been busy attending in-person conferences s… We've been busy attending in-person conferences such as IMMEM XIII and ASM NGS, so we thought we'd share some of our reflections with you. We discuss topics like waste water surveillance, hybrid conferences, and metadata, among other things. Waste Water Surveillance Waste water surveillance is becoming an increasingly vital tool in monitoring public health. By analyzing waste water, researchers can detect and predict outbreaks of diseases, providing an early warning system that can be crucial in implementing timely interventions. Hybrid Conferences As we transition back to in-person gatherings, hybrid conferences have emerged as a popular format. They offer the best of both worlds: in-person interaction with virtual accessibility, making conferences more inclusive and environmentally friendly. Metadata Metadata plays a crucial role in organizing and making sense of the massive amounts of data generated in research. Effective metadata management ensures data is easily searchable, shareable, and usable in various scientific analyses.... Read more at https://happykhan.com/microbinfie/mb-96-immem-xiii-and-asm-ngs-conference-roundup We've been busy attending in-person conferences such as IMMEM XIII and ASM NGS, so we thought we'd share some of our reflections with you. We discuss topics like waste water surveillance, hybrid conferences, and metadata, among other things. Waste Water Surveillance Waste water surveillance is becoming an increasingly vital tool in monitoring public health. By analyzing waste water, researchers can detect and predict outbreaks of diseases, providing an early warning system that can be crucial in implementing timely interventions. Hybrid Conferences As we transition back to in-person gatherings, hybrid conferences have emerged as a popular format. They offer the best of both worlds: in-person interaction with virtual accessibility, making conferences more inclusive and environmentally friendly. Metadata Metadata plays a crucial role in organizing and making sense of the massive amounts of data generated in research. Effective metadata management ensures data is easily searchable, shareable, and usable in various scientific analyses.... Read more at https://happykhan.com/microbinfie/mb-96-immem-xiii-and-asm-ngs-conference-roundup tag:soundcloud,2010:tracks/1360339576 https://soundcloud.com/microbinfie/lost-in-translation-with-torsten-seemann Thu, 08 Dec 2022 05:00:04 GMT 00:41:49 Microbial Bioinformatics no For the first time ever all 3 MicroBinfies are to… For the first time ever, all three MicroBinfies are together in person to record an episode. Joined by Torsten Seemann, we engage in a captivating discussion about how research, particularly in the realm of public health, can sometimes get lost in translation. We delve into our work with SARS-CoV-2 genomics, and somewhat unexpectedly, find ourselves chatting about geography and language. We hope you enjoy this special episode! Topics Discussed: The Intersection of Research and Public Health: - How scientific findings can lose their impact when translated into public health policy and practice. SARS-CoV-2 Genomics: - Our contributions and insights into the genomic study of SARS-CoV-2 and its implications for understanding the pandemic. Unexpected Tangents: - An engaging exploration of geography and language, illustrating the diverse interests and serendipitous nature of scientific conversations. Thank you for listening, and we hope you find the episode both informative and enjoyable! Key Points COVID-19... Read more at https://happykhan.com/microbinfie/mb-95-lost-in-translation-with-torsten-seemann For the first time ever, all three MicroBinfies are together in person to record an episode. Joined by Torsten Seemann, we engage in a captivating discussion about how research, particularly in the realm of public health, can sometimes get lost in translation. We delve into our work with SARS-CoV-2 genomics, and somewhat unexpectedly, find ourselves chatting about geography and language. We hope you enjoy this special episode! Topics Discussed: The Intersection of Research and Public Health: - How scientific findings can lose their impact when translated into public health policy and practice. SARS-CoV-2 Genomics: - Our contributions and insights into the genomic study of SARS-CoV-2 and its implications for understanding the pandemic. Unexpected Tangents: - An engaging exploration of geography and language, illustrating the diverse interests and serendipitous nature of scientific conversations. Thank you for listening, and we hope you find the episode both informative and enjoyable! Key Points COVID-19... Read more at https://happykhan.com/microbinfie/mb-95-lost-in-translation-with-torsten-seemann tag:soundcloud,2010:tracks/1381583065 https://soundcloud.com/microbinfie/the-great-scientific-mastodon-migration Thu, 17 Nov 2022 05:00:09 GMT 00:28:19 Microbial Bioinformatics no Over the past few weeks scientists have been swap… The microbinfie podcast explores the scientific community's migration from Twitter to Mastodon, highlighting the decentralized social media platform's emergence as a new digital communication space for researchers. Over the past few weeks, scientists have been transitioning from Twitter to Mastodon. Our very own Nabil-Fareed Alikhan discusses his experience setting up and running a Mastodon server called mstdn.science, which has become a new hub for scientists. Joining the conversation is Emma Hodcroft, providing an independent scientist’s perspective. In the MicroBinfie podcast, Andrew and Nabil talk about the migration of academics from Twitter to Mastodon, with Nabil playing a pivotal role in this shift. According to Nabil, Mastodon is a free and open web application designed for micro-blogging. It facilitates integration and communication between servers, allowing users to follow, reply, or read content from other servers. This migration began after Elon Musk acquired Twitter and implemented significant changes, raising concerns about freedom... Read more at https://happykhan.com/microbinfie/mb-94-the-great-scientific-mastodon-migration The microbinfie podcast explores the scientific community's migration from Twitter to Mastodon, highlighting the decentralized social media platform's emergence as a new digital communication space for researchers. Over the past few weeks, scientists have been transitioning from Twitter to Mastodon. Our very own Nabil-Fareed Alikhan discusses his experience setting up and running a Mastodon server called mstdn.science, which has become a new hub for scientists. Joining the conversation is Emma Hodcroft, providing an independent scientist’s perspective. In the MicroBinfie podcast, Andrew and Nabil talk about the migration of academics from Twitter to Mastodon, with Nabil playing a pivotal role in this shift. According to Nabil, Mastodon is a free and open web application designed for micro-blogging. It facilitates integration and communication between servers, allowing users to follow, reply, or read content from other servers. This migration began after Elon Musk acquired Twitter and implemented significant changes, raising concerns about freedom... Read more at https://happykhan.com/microbinfie/mb-94-the-great-scientific-mastodon-migration tag:soundcloud,2010:tracks/1284779149 https://soundcloud.com/microbinfie/93-roary-troubleshooting-and-issues Thu, 10 Nov 2022 02:00:02 GMT 00:16:47 Microbial Bioinformatics no We go through bug reports and issues and give ins… In this microbinfie podcast episode, the hosts explore the intersections of laboratory work, pandemic response, and bioinformatics, sharing personal experiences and insights from their professional journeys. Understanding Bug Reports in Bioinformatics Bioinformatics often involves complex software and algorithmic implementations that can lead to various technical issues. Addressing these requires a deep understanding of both the specific software and the biological data it handles. Common Underlying Problems Data Format Mismatches: - Bioinformatic tools often require data in specific formats. Misalignment in data formats can lead to processing errors. Software Updates: - Changes in software versions can result in compatibility issues or introduce new bugs. Algorithmic Errors: - Flaws in the logic of data processing algorithms can lead to incorrect results. Environmental Factors: - Dependencies and system environments, such as operating systems and libraries, can vary and cause unexpected behavior. Potential Solutions Standardization: - Adopting standardized data formats could mitigate format mismatch... Read more at https://happykhan.com/microbinfie/mb-93-roary-troubleshooting-and-issues In this microbinfie podcast episode, the hosts explore the intersections of laboratory work, pandemic response, and bioinformatics, sharing personal experiences and insights from their professional journeys. Understanding Bug Reports in Bioinformatics Bioinformatics often involves complex software and algorithmic implementations that can lead to various technical issues. Addressing these requires a deep understanding of both the specific software and the biological data it handles. Common Underlying Problems Data Format Mismatches: - Bioinformatic tools often require data in specific formats. Misalignment in data formats can lead to processing errors. Software Updates: - Changes in software versions can result in compatibility issues or introduce new bugs. Algorithmic Errors: - Flaws in the logic of data processing algorithms can lead to incorrect results. Environmental Factors: - Dependencies and system environments, such as operating systems and libraries, can vary and cause unexpected behavior. Potential Solutions Standardization: - Adopting standardized data formats could mitigate format mismatch... Read more at https://happykhan.com/microbinfie/mb-93-roary-troubleshooting-and-issues tag:soundcloud,2010:tracks/1284764644 https://soundcloud.com/microbinfie/avoid-dependency-hell-and-get-up-and-running-fast Thu, 27 Oct 2022 00:00:07 GMT 00:35:30 Microbial Bioinformatics no Often the hard part of bioinformatics isnt the an… The microbinfie podcast explores the complex world of software dependency management, revealing the historical challenges and modern solutions for installing and maintaining bioinformatics tools. Often, the hard part of bioinformatics isn't the analysis—it's setting up and installing all the software you need. Join us on this journey and avoid dependency hell. In the MicroBinfie podcast, the hosts discuss the struggles of installing, managing, and dealing with dependencies in bioinformatics software. Challenges in Bioinformatics Software Installation In the past, software installations were a nightmare. It was common to edit lines of code and manage dependencies manually, often causing conflicts like the infamous "diamond dependency." To ease this process, the hosts suggest using containers, virtual machines, and local environments. They stress the importance of adhering to semantic versioning guidelines and understanding the end-user's perspective for proper documentation, testing, and clarity regarding dependencies. Additionally, software maintenance is critical for its longevity and usability.... Read more at https://happykhan.com/microbinfie/mb-92-avoid-dependency-hell-and-get-up-and-running-fast The microbinfie podcast explores the complex world of software dependency management, revealing the historical challenges and modern solutions for installing and maintaining bioinformatics tools. Often, the hard part of bioinformatics isn't the analysis—it's setting up and installing all the software you need. Join us on this journey and avoid dependency hell. In the MicroBinfie podcast, the hosts discuss the struggles of installing, managing, and dealing with dependencies in bioinformatics software. Challenges in Bioinformatics Software Installation In the past, software installations were a nightmare. It was common to edit lines of code and manage dependencies manually, often causing conflicts like the infamous "diamond dependency." To ease this process, the hosts suggest using containers, virtual machines, and local environments. They stress the importance of adhering to semantic versioning guidelines and understanding the end-user's perspective for proper documentation, testing, and clarity regarding dependencies. Additionally, software maintenance is critical for its longevity and usability.... Read more at https://happykhan.com/microbinfie/mb-92-avoid-dependency-hell-and-get-up-and-running-fast tag:soundcloud,2010:tracks/1284484477 https://soundcloud.com/microbinfie/91-what-language-should-i-learn Thu, 13 Oct 2022 01:00:08 GMT 00:29:48 Microbial Bioinformatics no The MicroBinfie podcast discusses the top program… The microbinfie podcast explores the critical landscape of programming languages for bioinformatics researchers, offering nuanced guidance for emerging computational scientists. Hosts discuss language selection strategies, learning paths, and the importance of adaptability in scientific computing. Here are the key takeaways from their discussion: Python Starting Point: The hosts agree that Python is an excellent starting point due to its consistency and rigor. Its strict syntax makes it ideal for learning programming fundamentals essential in any language. Perl Comparison to Python: Perl allows for multiple ways of doing the same task, which can lead to confusion and difficulty in managing code. Language Trends Trendy Languages: The hosts caution against starting with trendy languages that are frequently changing. Instead, they recommend sticking to established languages like Python, which offer robust libraries and concepts that facilitate learning and advancement. Databases Importance of SQL: Understanding databases is crucial, with SQL being particularly useful for... Read more at https://happykhan.com/microbinfie/mb-91-what-language-should-i-learn The microbinfie podcast explores the critical landscape of programming languages for bioinformatics researchers, offering nuanced guidance for emerging computational scientists. Hosts discuss language selection strategies, learning paths, and the importance of adaptability in scientific computing. Here are the key takeaways from their discussion: Python Starting Point: The hosts agree that Python is an excellent starting point due to its consistency and rigor. Its strict syntax makes it ideal for learning programming fundamentals essential in any language. Perl Comparison to Python: Perl allows for multiple ways of doing the same task, which can lead to confusion and difficulty in managing code. Language Trends Trendy Languages: The hosts caution against starting with trendy languages that are frequently changing. Instead, they recommend sticking to established languages like Python, which offer robust libraries and concepts that facilitate learning and advancement. Databases Importance of SQL: Understanding databases is crucial, with SQL being particularly useful for... Read more at https://happykhan.com/microbinfie/mb-91-what-language-should-i-learn tag:soundcloud,2010:tracks/1284274303 https://soundcloud.com/microbinfie/public-health-bioinformatics-on-the-cloud-with-wdl-terrabio Thu, 29 Sep 2022 00:00:02 GMT 00:44:19 Microbial Bioinformatics no 90 Public health bioinformatics on the cloud with… The microbinfie podcast explores Terra.bio, a cloud-based platform transforming bioinformatics workflows and public health genomic research through accessible, portable computational technologies. Key Components Workflow Description Language (WDL) Purpose: WDL is a human-readable language designed to express computational workflows. Benefits: - Simplifies complex computational processes. - Enhances reproducibility and portability of workflows. Terra.bio Platform: Terra.bio is a secure, scalable, and collaborative environment for conducting biomedical research in the cloud. Features: - Data Management: Facilitates storage, sharing, and management of large genomic datasets. - Collaboration Tools: Supports interdisciplinary teams by providing shared access to data and computational resources. - Integrations: Offers integration with popular bioinformatics tools and databases. Applications in Public Health Utilizing WDL and Terra.bio in public health bioinformatics provides several advantages: Scalability: The cloud-based approach allows for handling increasing volumes of genomic data without the need for local infrastructure. Cost-Effectiveness: Reduces the overall cost of data processing and storage by... Read more at https://happykhan.com/microbinfie/mb-90-public-health-bioinformatics-on-the-cloud-with-wdl-terra-bio The microbinfie podcast explores Terra.bio, a cloud-based platform transforming bioinformatics workflows and public health genomic research through accessible, portable computational technologies. Key Components Workflow Description Language (WDL) Purpose: WDL is a human-readable language designed to express computational workflows. Benefits: - Simplifies complex computational processes. - Enhances reproducibility and portability of workflows. Terra.bio Platform: Terra.bio is a secure, scalable, and collaborative environment for conducting biomedical research in the cloud. Features: - Data Management: Facilitates storage, sharing, and management of large genomic datasets. - Collaboration Tools: Supports interdisciplinary teams by providing shared access to data and computational resources. - Integrations: Offers integration with popular bioinformatics tools and databases. Applications in Public Health Utilizing WDL and Terra.bio in public health bioinformatics provides several advantages: Scalability: The cloud-based approach allows for handling increasing volumes of genomic data without the need for local infrastructure. Cost-Effectiveness: Reduces the overall cost of data processing and storage by... Read more at https://happykhan.com/microbinfie/mb-90-public-health-bioinformatics-on-the-cloud-with-wdl-terra-bio tag:soundcloud,2010:tracks/1284129610 https://soundcloud.com/microbinfie/what-do-we-do-with-wdl Thu, 15 Sep 2022 02:00:00 GMT 00:26:08 Microbial Bioinformatics no Today on the @microbinfie podcast, we talk about … The microbinfie podcast explores Workflow Description Language (WDL), a critical tool for standardizing and simplifying bioinformatics pipeline development and deployment across different computational environments. Highlights of the Episode Introduction to WDL: The podcast delves into the functionality of WDL, a language commonly used to describe bioinformatics pipelines in a portable and cross-environmental manner. WDL's strength lies in its ability to effectively connect pre-containerized tools, standardizing bioinformatics processes which enhances reproducibility and scalability. By doing this, it minimizes the need for complex CIS (Computer Information Systems) admin work, allowing researchers to concentrate more on scientific inquiries. Unique Features of WDL: Despite the existence of various workflow languages, WDL stands out due to its formal specification and its compatibility with common implementations used for execution. Public Health Bioinformatics: Joel and Danny discuss the implications of workflow languages in the realm of public health bioinformatics, particularly addressing challenges related to version control and... Read more at https://happykhan.com/microbinfie/mb-89-what-do-we-do-with-wdl The microbinfie podcast explores Workflow Description Language (WDL), a critical tool for standardizing and simplifying bioinformatics pipeline development and deployment across different computational environments. Highlights of the Episode Introduction to WDL: The podcast delves into the functionality of WDL, a language commonly used to describe bioinformatics pipelines in a portable and cross-environmental manner. WDL's strength lies in its ability to effectively connect pre-containerized tools, standardizing bioinformatics processes which enhances reproducibility and scalability. By doing this, it minimizes the need for complex CIS (Computer Information Systems) admin work, allowing researchers to concentrate more on scientific inquiries. Unique Features of WDL: Despite the existence of various workflow languages, WDL stands out due to its formal specification and its compatibility with common implementations used for execution. Public Health Bioinformatics: Joel and Danny discuss the implications of workflow languages in the realm of public health bioinformatics, particularly addressing challenges related to version control and... Read more at https://happykhan.com/microbinfie/mb-89-what-do-we-do-with-wdl tag:soundcloud,2010:tracks/1144720606 https://soundcloud.com/microbinfie/sepia-directors-cut Thu, 04 Aug 2022 04:00:02 GMT 00:53:01 Microbial Bioinformatics no This is an extended directors cut of our chat wit… In this episode of the microbinfie podcast, Dr. Henk den Bakker discusses Sepia, a novel read classification tool developed in Rust to address computational challenges in metagenomics and taxonomic analysis. Useful Links Get Sepia: GitHub Repository Food Safety Informatics Group at UGA: Deng Lab Website Programming Language - Rust: Official Site Kalamari Software: GitHub Repository CAMI (Critical Assessment of Metagenome Interpretation): Nature Article Key Points Sepia: A Next-Generation Read Classifier Uses complex hash table and taxonomy-aware classification approach Implemented in Rust for high-performance computational efficiency Supports extended k-mer sizes and batch processing modes Computational Innovations Enables flexible taxonomy integration (e.g., GTDB vs NCBI taxonomies) Implements novel hit ratio metrics for accurate read classification Leverages compact data structures with perfect hash functions Applied Research Applications Metagenomics for tracking animal intrusion in farmlands Microbiome mapping in food safety environments Potential for pathogen detection in environmental samples Take-Home Messages Rust provides significant performance... Read more at https://happykhan.com/microbinfie/mb-88-sepia-directors-cut In this episode of the microbinfie podcast, Dr. Henk den Bakker discusses Sepia, a novel read classification tool developed in Rust to address computational challenges in metagenomics and taxonomic analysis. Useful Links Get Sepia: GitHub Repository Food Safety Informatics Group at UGA: Deng Lab Website Programming Language - Rust: Official Site Kalamari Software: GitHub Repository CAMI (Critical Assessment of Metagenome Interpretation): Nature Article Key Points Sepia: A Next-Generation Read Classifier Uses complex hash table and taxonomy-aware classification approach Implemented in Rust for high-performance computational efficiency Supports extended k-mer sizes and batch processing modes Computational Innovations Enables flexible taxonomy integration (e.g., GTDB vs NCBI taxonomies) Implements novel hit ratio metrics for accurate read classification Leverages compact data structures with perfect hash functions Applied Research Applications Metagenomics for tracking animal intrusion in farmlands Microbiome mapping in food safety environments Potential for pathogen detection in environmental samples Take-Home Messages Rust provides significant performance... Read more at https://happykhan.com/microbinfie/mb-88-sepia-directors-cut tag:soundcloud,2010:tracks/1283756557 https://soundcloud.com/microbinfie/nextstrain-sarscov2-and-dealing-with-a-data-deluge Thu, 21 Jul 2022 00:00:02 GMT 00:27:56 Microbial Bioinformatics no 87 Nextstrain, SARSCOV2 and dealing with a data d… The microbinfie podcast explores the evolution of Nextstrain, a powerful bioinformatics platform for tracking viral genomic data during the SARS-CoV-2 pandemic, highlighting the technical challenges of managing massive genomic datasets. The global outbreak of SARS-CoV-2 has initiated a massive influx of data, requiring robust tools to analyze and interpret these datasets effectively. Nextstrain, an open-source project, provides a powerful platform for tracking pathogen evolution in real-time, harnessing data deluge from SARS-CoV-2 to deliver insights into viral transmission and mutation. Key Topics Nextstrain: This platform integrates data from various genomic sources to visualize pathogen spread. It helps researchers and public health officials understand the dynamics of virus mutations and plan interventions accordingly. SARS-CoV-2: The novel coronavirus responsible for the COVID-19 pandemic. Studying its genome is crucial for developing treatment strategies and vaccines. Data Deluge: With the pandemic's rapid spread, there is an unprecedented amount of genomic data being generated. Efficiently managing... Read more at https://happykhan.com/microbinfie/mb-87-nextstrain-sarscov2-and-dealing-with-a-data-deluge The microbinfie podcast explores the evolution of Nextstrain, a powerful bioinformatics platform for tracking viral genomic data during the SARS-CoV-2 pandemic, highlighting the technical challenges of managing massive genomic datasets. The global outbreak of SARS-CoV-2 has initiated a massive influx of data, requiring robust tools to analyze and interpret these datasets effectively. Nextstrain, an open-source project, provides a powerful platform for tracking pathogen evolution in real-time, harnessing data deluge from SARS-CoV-2 to deliver insights into viral transmission and mutation. Key Topics Nextstrain: This platform integrates data from various genomic sources to visualize pathogen spread. It helps researchers and public health officials understand the dynamics of virus mutations and plan interventions accordingly. SARS-CoV-2: The novel coronavirus responsible for the COVID-19 pandemic. Studying its genome is crucial for developing treatment strategies and vaccines. Data Deluge: With the pandemic's rapid spread, there is an unprecedented amount of genomic data being generated. Efficiently managing... Read more at https://happykhan.com/microbinfie/mb-87-nextstrain-sarscov2-and-dealing-with-a-data-deluge tag:soundcloud,2010:tracks/1283726296 https://soundcloud.com/microbinfie/85-whats-next-for-nextstrain Thu, 07 Jul 2022 01:00:07 GMT 00:22:55 Microbial Bioinformatics no 86 What's next for nextstrain? by Microbial Bioin… The microbinfie podcast explores Nextstrain, an innovative bioinformatics platform for tracking and visualizing pathogen evolution, featuring insights from key developers about its technological approach and future potential. Key Points Nextstrain Platform Overview Combination of website (nextstrain.org) and software package Uses phylogenetic analysis to track pathogen genome evolution Originated in 2014-2015, initially focused on influenza tracking Technical Architecture Consists of two primary components: Augur (analysis pipeline) and Auspice (visualization) Primarily implemented in Python, with React and JavaScript for web visualization Leverages existing computational tools like FastTree and IQtree Collaborative Development Model Distributed global team of approximately 10-12 core contributors Relies on asynchronous communication via Slack and GitHub Extends beyond viruses to include bacterial genome tracking Take-Home Messages Nextstrain provides an accessible platform for tracking pathogen evolution Collaborative, open-source approach enables continuous platform improvement Visualization and real-time analysis are key strengths of the platform The microbinfie podcast explores Nextstrain, an innovative bioinformatics platform for tracking and visualizing pathogen evolution, featuring insights from key developers about its technological approach and future potential. Key Points Nextstrain Platform Overview Combination of website (nextstrain.org) and software package Uses phylogenetic analysis to track pathogen genome evolution Originated in 2014-2015, initially focused on influenza tracking Technical Architecture Consists of two primary components: Augur (analysis pipeline) and Auspice (visualization) Primarily implemented in Python, with React and JavaScript for web visualization Leverages existing computational tools like FastTree and IQtree Collaborative Development Model Distributed global team of approximately 10-12 core contributors Relies on asynchronous communication via Slack and GitHub Extends beyond viruses to include bacterial genome tracking Take-Home Messages Nextstrain provides an accessible platform for tracking pathogen evolution Collaborative, open-source approach enables continuous platform improvement Visualization and real-time analysis are key strengths of the platform tag:soundcloud,2010:tracks/1242555994 https://soundcloud.com/microbinfie/85-breaking-the-dogma-with-bioinformatics Thu, 23 Jun 2022 04:00:03 GMT 00:27:15 Microbial Bioinformatics no We are joined again by Prof Mark Pallen who takes… The microbinfie podcast features Professor Mark Pallen's pioneering journey through high-throughput microbial genomics, exploring transformative moments in genomic sequencing and epidemiology during the early 2010s. We are joined again by Prof. Mark Pallen as he discusses his early experiences in high-throughput microbial genomics. Mark was delighted to have persuaded Nick Loman to join him in Birmingham. Together, they collaborated with George Weinstock to perform the first genome sequence analyses of Gram-negatives for genomic epidemiology, focusing on multi-drug resistant Acinetobacter baumannii. After winning an Ion Torrent sequencer in a competition, Mark and Nick contributed pioneering genomic analyses of the German STEC outbreak. One of their studies involved crowdsourced approaches, facilitated by Twitter, and was published in the New England Journal of Medicine. The other study provided a performance comparison of newly launched benchtop sequencing platforms. Mark, Lee, and Nabil discuss how this outbreak challenged existing dogmas concerning the archetypal status of... Read more at https://happykhan.com/microbinfie/mb-85-breaking-the-dogma-with-bioinformatics The microbinfie podcast features Professor Mark Pallen's pioneering journey through high-throughput microbial genomics, exploring transformative moments in genomic sequencing and epidemiology during the early 2010s. We are joined again by Prof. Mark Pallen as he discusses his early experiences in high-throughput microbial genomics. Mark was delighted to have persuaded Nick Loman to join him in Birmingham. Together, they collaborated with George Weinstock to perform the first genome sequence analyses of Gram-negatives for genomic epidemiology, focusing on multi-drug resistant Acinetobacter baumannii. After winning an Ion Torrent sequencer in a competition, Mark and Nick contributed pioneering genomic analyses of the German STEC outbreak. One of their studies involved crowdsourced approaches, facilitated by Twitter, and was published in the New England Journal of Medicine. The other study provided a performance comparison of newly launched benchtop sequencing platforms. Mark, Lee, and Nabil discuss how this outbreak challenged existing dogmas concerning the archetypal status of... Read more at https://happykhan.com/microbinfie/mb-85-breaking-the-dogma-with-bioinformatics tag:soundcloud,2010:tracks/1241965861 https://soundcloud.com/microbinfie/bioinformatics-in-the-noughties Thu, 09 Jun 2022 04:00:04 GMT 00:22:14 Microbial Bioinformatics no Mark Pallen explains how exciting it was to be in… Mark Pallen describes the excitement surrounding the field of microbial bioinformatics at the turn of the millennium, as scientists began to obtain genomes from model organisms and dangerous pathogens for the first time. He recounts collaborating with his hero, David Relman, on the genome sequencing of the unusual slow-growing organism, Tropheryma whipplei, in a race against a French team. In late 1999, Mark moved to Belfast and began collaborating with another Englishman based in Ireland, Tim Foster, who was working in Dublin. Pallen describes the exhilarating experience of using PSI-BLAST to identify new sortases and sortase substrates across various new genomes, likening it to the addictive nature of "crack cocaine." He references philosopher Alfred North Whitehead, quoting that the aim of every scientist is "to seek simplicity but distrust it." Pallen discovered that sortases in most organisms behaved quite differently from the simple model observed in Staphylococcus aureus. He made... Read more at https://happykhan.com/microbinfie/mb-84-bioinformatics-in-the-noughties-with-mark-pallen Mark Pallen describes the excitement surrounding the field of microbial bioinformatics at the turn of the millennium, as scientists began to obtain genomes from model organisms and dangerous pathogens for the first time. He recounts collaborating with his hero, David Relman, on the genome sequencing of the unusual slow-growing organism, Tropheryma whipplei, in a race against a French team. In late 1999, Mark moved to Belfast and began collaborating with another Englishman based in Ireland, Tim Foster, who was working in Dublin. Pallen describes the exhilarating experience of using PSI-BLAST to identify new sortases and sortase substrates across various new genomes, likening it to the addictive nature of "crack cocaine." He references philosopher Alfred North Whitehead, quoting that the aim of every scientist is "to seek simplicity but distrust it." Pallen discovered that sortases in most organisms behaved quite differently from the simple model observed in Staphylococcus aureus. He made... Read more at https://happykhan.com/microbinfie/mb-84-bioinformatics-in-the-noughties-with-mark-pallen tag:soundcloud,2010:tracks/1233380629 https://soundcloud.com/microbinfie/a-short-journey-into-mobile-genetic-elements Thu, 26 May 2022 04:00:00 GMT 00:17:39 Microbial Bioinformatics no We discuss mobile genetic elements in bacteria an… The microbinfie podcast explores the complex world of mobile genetic elements (MGEs) in bacterial genomes, revealing the intricate mechanisms of genetic mobility and the computational challenges in identifying and characterizing these dynamic genomic components. Mobile Genetic Elements (MGEs): - MGEs are genomic elements that can move within or between genomes, such as bacteriophages, transposons, plasmids, genomic islands, integrative conjugative elements, and integrons. - They exhibit diverse appearances and mechanisms for transfer, complicating their identification and characterization. - MGEs can be integrated in genomes without obvious signatures, making their study challenging. Challenges in Sequencing and Assembly: - Short-read Sequencing: - Short reads may struggle to accurately sequence regions with repeated IS elements, leading to assembly issues. - For example, strains like Vibrio showed complications that were resolved by long-read technologies like PacBio. - Short reads may not distinguish between genuine genomic events and assembly errors due to their limited range. -... Read more at https://happykhan.com/microbinfie/mb-83-a-short-journey-into-mobile-genetic-elements The microbinfie podcast explores the complex world of mobile genetic elements (MGEs) in bacterial genomes, revealing the intricate mechanisms of genetic mobility and the computational challenges in identifying and characterizing these dynamic genomic components. Mobile Genetic Elements (MGEs): - MGEs are genomic elements that can move within or between genomes, such as bacteriophages, transposons, plasmids, genomic islands, integrative conjugative elements, and integrons. - They exhibit diverse appearances and mechanisms for transfer, complicating their identification and characterization. - MGEs can be integrated in genomes without obvious signatures, making their study challenging. Challenges in Sequencing and Assembly: - Short-read Sequencing: - Short reads may struggle to accurately sequence regions with repeated IS elements, leading to assembly issues. - For example, strains like Vibrio showed complications that were resolved by long-read technologies like PacBio. - Short reads may not distinguish between genuine genomic events and assembly errors due to their limited range. -... Read more at https://happykhan.com/microbinfie/mb-83-a-short-journey-into-mobile-genetic-elements tag:soundcloud,2010:tracks/1240140109 https://soundcloud.com/microbinfie/bioinformatics-moments-before-the-millennium Thu, 12 May 2022 03:00:03 GMT 00:39:57 Microbial Bioinformatics no In this episode we talk to Professor Mark Pallen,… Professor Mark Pallen traces his journey in bioinformatics on the microbinfie podcast, revealing the transformative early moments of computational biology before the millennium. Early Days in Bioinformatics Mark's journey into bioinformatics began in 1977. This was the year Fred Sanger revolutionized DNA sequencing as we know it today. At the time, Mark was tasked with assembling amino acid sequences under exam conditions. He shares with us how little was known about sequences then and his initial grasp of molecular biology. Career Milestones Bart's Hospital and a Eureka Moment: In the late 1980s, at Bart's Hospital in London, Mark met Brendan Wren. His first eureka moment came when he analyzed sequences encoding the enzyme urease from Helicobacter pylori. He also studied genes from a clostridial butanol fermentation pathway, which he intriguingly notes played a critical role in the formation of the state of Israel. PhD with Gordon Dougan: Mark's next big... Read more at https://happykhan.com/microbinfie/mb-82-bioinformatics-moments-before-the-millennium Professor Mark Pallen traces his journey in bioinformatics on the microbinfie podcast, revealing the transformative early moments of computational biology before the millennium. Early Days in Bioinformatics Mark's journey into bioinformatics began in 1977. This was the year Fred Sanger revolutionized DNA sequencing as we know it today. At the time, Mark was tasked with assembling amino acid sequences under exam conditions. He shares with us how little was known about sequences then and his initial grasp of molecular biology. Career Milestones Bart's Hospital and a Eureka Moment: In the late 1980s, at Bart's Hospital in London, Mark met Brendan Wren. His first eureka moment came when he analyzed sequences encoding the enzyme urease from Helicobacter pylori. He also studied genes from a clostridial butanol fermentation pathway, which he intriguingly notes played a critical role in the formation of the state of Israel. PhD with Gordon Dougan: Mark's next big... Read more at https://happykhan.com/microbinfie/mb-82-bioinformatics-moments-before-the-millennium tag:soundcloud,2010:tracks/1199120434 https://soundcloud.com/microbinfie/behind-sars-cov-2-datasets Fri, 29 Apr 2022 04:01:11 GMT 00:09:27 Microbial Bioinformatics no We bring on Lingzi Xiaoli and Jill Hagey to talk … The microbinfie podcast explores the intricate process of developing benchmark datasets for SARS-CoV-2, highlighting the complex challenges of bioinformatics data mining and quality control. Links and Resources Explore the datasets: CDC SARS-CoV-2 Datasets Check out a previous related episode for part 1 of the conversation. Related Works Previous paper on bacterial datasets: PeerJ Article Connect with Our Guests Jill Hagey: - Twitter: @JillHagey - Website: jvhagey.github.io Lingzi Xiaoli: - LinkedIn: Lingzi Xiaoli Stay tuned to learn more about the insights and implications of these datasets in the field of virology and genomics. Extra notes The discussion revolves around creating benchmark datasets for SARS-CoV-2 and the methods used in acquiring and processing these datasets. Jill explored using the Python package Selenium to automate the process of downloading sequences by remotely interacting with web browsers, although this approach was later abandoned in favor of more efficient methods. Checking and verifying metadata for... Read more at https://happykhan.com/microbinfie/mb-81-the-people-behind-the-benchmark-datasets-for-sars-cov-2 The microbinfie podcast explores the intricate process of developing benchmark datasets for SARS-CoV-2, highlighting the complex challenges of bioinformatics data mining and quality control. Links and Resources Explore the datasets: CDC SARS-CoV-2 Datasets Check out a previous related episode for part 1 of the conversation. Related Works Previous paper on bacterial datasets: PeerJ Article Connect with Our Guests Jill Hagey: - Twitter: @JillHagey - Website: jvhagey.github.io Lingzi Xiaoli: - LinkedIn: Lingzi Xiaoli Stay tuned to learn more about the insights and implications of these datasets in the field of virology and genomics. Extra notes The discussion revolves around creating benchmark datasets for SARS-CoV-2 and the methods used in acquiring and processing these datasets. Jill explored using the Python package Selenium to automate the process of downloading sequences by remotely interacting with web browsers, although this approach was later abandoned in favor of more efficient methods. Checking and verifying metadata for... Read more at https://happykhan.com/microbinfie/mb-81-the-people-behind-the-benchmark-datasets-for-sars-cov-2 tag:soundcloud,2010:tracks/1199119282 https://soundcloud.com/microbinfie/sars-cov-2-datasets-part-1 Thu, 28 Apr 2022 04:00:11 GMT 00:43:05 Microbial Bioinformatics no We bring on Lingzi Xiaoli and Jill Hagey to talk … In this episode of the microbinfie podcast, researchers from the CDC discuss their comprehensive benchmark datasets for SARS-CoV-2 genome sequencing, addressing critical needs in bioinformatics pipeline validation and quality control. Additional Resources For details on previous papers related to bacterial datasets, you can refer to this article. Connect with the Researchers Jill Hagey can be found on Twitter @JillHagey and through her website at jvhagey.github.io. Lingzi Xiaoli can be connected with on LinkedIn. Both researchers bring valuable insights into the development of datasets that contribute significantly to the scientific community's understanding of SARS-CoV-2. Key Points SARS-CoV-2 Benchmark Dataset Development Created to support state partners in developing bioinformatics pipelines Designed to accommodate labs at different stages of sequencing capabilities Includes diverse sample types: outbreak scenarios, sequencing platform variations, and failed QC samples Dataset Characteristics Covers multiple SARS-CoV-2 variants, including early Delta variants Provides raw reads, complete genomes, and phylogenetic trees Addresses... Read more at https://happykhan.com/microbinfie/mb-80-benchmark-datasets-for-sars-cov-2 In this episode of the microbinfie podcast, researchers from the CDC discuss their comprehensive benchmark datasets for SARS-CoV-2 genome sequencing, addressing critical needs in bioinformatics pipeline validation and quality control. Additional Resources For details on previous papers related to bacterial datasets, you can refer to this article. Connect with the Researchers Jill Hagey can be found on Twitter @JillHagey and through her website at jvhagey.github.io. Lingzi Xiaoli can be connected with on LinkedIn. Both researchers bring valuable insights into the development of datasets that contribute significantly to the scientific community's understanding of SARS-CoV-2. Key Points SARS-CoV-2 Benchmark Dataset Development Created to support state partners in developing bioinformatics pipelines Designed to accommodate labs at different stages of sequencing capabilities Includes diverse sample types: outbreak scenarios, sequencing platform variations, and failed QC samples Dataset Characteristics Covers multiple SARS-CoV-2 variants, including early Delta variants Provides raw reads, complete genomes, and phylogenetic trees Addresses... Read more at https://happykhan.com/microbinfie/mb-80-benchmark-datasets-for-sars-cov-2 tag:soundcloud,2010:tracks/1232844328 https://soundcloud.com/microbinfie/staph-b-stable-containers Thu, 14 Apr 2022 04:00:04 GMT 00:28:17 Microbial Bioinformatics no Dr Erin Young from the Utah Department of Health … The microbinfie podcast explores the StaPH-B Docker repository and toolkit, highlighting innovative approaches to simplifying bioinformatics workflows for public health laboratories through containerization technology. Dr. Erin Young from the Utah Department of Health and Dr. Kelsey Florek from the Wisconsin State Laboratory of Hygiene join us to discuss StaPH-B containers for public health bioinformatics. It's essentially about making biology easier for everyone! About StaPH-B StaPH-B, which stands for State Public Health Bioinformatics, is a collaborative effort to streamline and enhance bioinformatics workflows in the realm of public health. The use of StaPH-B containers can significantly simplify the complex processes involved in bioinformatics, making these advanced scientific techniques more accessible to public health professionals. Key Features of StaPH-B: Containerized workflows that facilitate easier deployment and sharing of bioinformatics tools. Focus on public health applications, addressing the unique needs and challenges faced by state health laboratories. An open-source community that encourages collaboration... Read more at https://happykhan.com/microbinfie/mb-79-staph-b-stable-containers-for-public-health-bioinformatics The microbinfie podcast explores the StaPH-B Docker repository and toolkit, highlighting innovative approaches to simplifying bioinformatics workflows for public health laboratories through containerization technology. Dr. Erin Young from the Utah Department of Health and Dr. Kelsey Florek from the Wisconsin State Laboratory of Hygiene join us to discuss StaPH-B containers for public health bioinformatics. It's essentially about making biology easier for everyone! About StaPH-B StaPH-B, which stands for State Public Health Bioinformatics, is a collaborative effort to streamline and enhance bioinformatics workflows in the realm of public health. The use of StaPH-B containers can significantly simplify the complex processes involved in bioinformatics, making these advanced scientific techniques more accessible to public health professionals. Key Features of StaPH-B: Containerized workflows that facilitate easier deployment and sharing of bioinformatics tools. Focus on public health applications, addressing the unique needs and challenges faced by state health laboratories. An open-source community that encourages collaboration... Read more at https://happykhan.com/microbinfie/mb-79-staph-b-stable-containers-for-public-health-bioinformatics tag:soundcloud,2010:tracks/1232913649 https://soundcloud.com/microbinfie/staph-b-state-public-health Thu, 31 Mar 2022 04:00:03 GMT 00:25:33 Microbial Bioinformatics no Dr. Erin Young and Dr Kelsey Florek join us to ta… The microbinfie podcast explores the State Public Health Bioinformatics (StaPH-B) workgroup and its critical role in connecting bioinformaticians across state public health laboratories during the COVID-19 pandemic. Dr. Erin Young and Dr. Kelsey Florek recently joined us to discuss StaPH-B, a U.S. state public health bioinformatics group, and provided insights into the popular SARS-CoV-2 pipeline, Cecret. Website: staphb.org Cecret Pipeline: GitHub Repository About StaPH-B Kelsey Florek explained that StaPH-B was created to facilitate collaborations between bioinformaticians in state public health laboratories. This group is particularly beneficial for those who are new to sequencing and understanding the data generated. It provides a communication and expertise network among different laboratories, contributing to projects funded by the NIH, CDC, and other grant agencies. Erin Young highlighted the diverse membership of StaPH-B, which offers excellent learning opportunities. With nearly 400 members and over 50 channels focused on bioinformatics, StaPH-B uses a Slack workspace to... Read more at https://happykhan.com/microbinfie/mb-78-staph-b-state-public-health-bioinformatics The microbinfie podcast explores the State Public Health Bioinformatics (StaPH-B) workgroup and its critical role in connecting bioinformaticians across state public health laboratories during the COVID-19 pandemic. Dr. Erin Young and Dr. Kelsey Florek recently joined us to discuss StaPH-B, a U.S. state public health bioinformatics group, and provided insights into the popular SARS-CoV-2 pipeline, Cecret. Website: staphb.org Cecret Pipeline: GitHub Repository About StaPH-B Kelsey Florek explained that StaPH-B was created to facilitate collaborations between bioinformaticians in state public health laboratories. This group is particularly beneficial for those who are new to sequencing and understanding the data generated. It provides a communication and expertise network among different laboratories, contributing to projects funded by the NIH, CDC, and other grant agencies. Erin Young highlighted the diverse membership of StaPH-B, which offers excellent learning opportunities. With nearly 400 members and over 50 channels focused on bioinformatics, StaPH-B uses a Slack workspace to... Read more at https://happykhan.com/microbinfie/mb-78-staph-b-state-public-health-bioinformatics tag:soundcloud,2010:tracks/1131784483 https://soundcloud.com/microbinfie/genomics-for-a-new-era Thu, 17 Mar 2022 03:00:03 GMT 00:38:16 Microbial Bioinformatics no Today we’re talking about some exciting new devel… The microbinfie podcast delves into cutting-edge developments in comparative genomics, featuring insights from computational biologists at the European Bioinformatics Institute (EBI) and Wellcome Sanger Institute. The episode explores innovative approaches to analyzing massive bacterial genomic datasets and understanding genetic variation. Today, we’re discussing some exciting new developments in the area of comparative genomics. We are joined by Dr. Zamin Iqbal, a Research Group Leader at the European Bioinformatics Institute, and Dr. Grace Blackwell, who is jointly affiliated with the European Bioinformatics Institute, working in Dr. Zamin Iqbal's group, as well as in Nick Thomson’s team at the Wellcome Sanger Institute. Comparative genomics is a fascinating field that involves comparing the genomes of different species to understand their evolutionary relationships, functional biology, and genetic diversity. This field plays a crucial role in numerous scientific and medical advancements, making these developments particularly impactful. Key Points Computational Genomics Challenges Challenges in querying and... Read more at https://happykhan.com/microbinfie/mb-77-genomics-for-a-new-era The microbinfie podcast delves into cutting-edge developments in comparative genomics, featuring insights from computational biologists at the European Bioinformatics Institute (EBI) and Wellcome Sanger Institute. The episode explores innovative approaches to analyzing massive bacterial genomic datasets and understanding genetic variation. Today, we’re discussing some exciting new developments in the area of comparative genomics. We are joined by Dr. Zamin Iqbal, a Research Group Leader at the European Bioinformatics Institute, and Dr. Grace Blackwell, who is jointly affiliated with the European Bioinformatics Institute, working in Dr. Zamin Iqbal's group, as well as in Nick Thomson’s team at the Wellcome Sanger Institute. Comparative genomics is a fascinating field that involves comparing the genomes of different species to understand their evolutionary relationships, functional biology, and genetic diversity. This field plays a crucial role in numerous scientific and medical advancements, making these developments particularly impactful. Key Points Computational Genomics Challenges Challenges in querying and... Read more at https://happykhan.com/microbinfie/mb-77-genomics-for-a-new-era tag:soundcloud,2010:tracks/1163015572 https://soundcloud.com/microbinfie/what-are-the-major-challenges-for-getting-amr-genomics-into-the-clinic Thu, 03 Mar 2022 05:00:00 GMT 00:41:12 Microbial Bioinformatics no What are the major challenges for getting AMR gen… The integration of antimicrobial resistance (AMR) genomics into clinical settings presents several significant challenges. These were the focus of a panel discussion during the 7th Microbial Bioinformatics Hackathon, organized in association with JPIAMR, PHA4GE, and CLIMB. The panel comprised experts from various institutions: Mark Pallen from the Quadram Institute Bioscience, UK Finlay Maguire from Dalhousie University, Canada Anthony Underwood from the Centre for Genomic Pathogen Surveillance, UK Clement Tsui from Weill Cornell Medicine, Qatar The session was chaired by Andrew Page, with support from Lee Katz. Key Challenges Discussed: Data Interpretation and Standardization: - Harmonizing diverse data types for consistent interpretation across different genomic platforms. - Developing standardized guidelines for interpreting genomic data in the clinical context. Infrastructure and Resources: - The need for robust computational infrastructure to handle large-scale genomic data. - Ensuring access to necessary resources and funding for ongoing genomic initiatives. Clinical Utility and Integration: - Demonstrating... Read more at https://happykhan.com/microbinfie/mb-76-what-are-the-major-challenges-for-getting-amr-genomics-into-the-clinic The integration of antimicrobial resistance (AMR) genomics into clinical settings presents several significant challenges. These were the focus of a panel discussion during the 7th Microbial Bioinformatics Hackathon, organized in association with JPIAMR, PHA4GE, and CLIMB. The panel comprised experts from various institutions: Mark Pallen from the Quadram Institute Bioscience, UK Finlay Maguire from Dalhousie University, Canada Anthony Underwood from the Centre for Genomic Pathogen Surveillance, UK Clement Tsui from Weill Cornell Medicine, Qatar The session was chaired by Andrew Page, with support from Lee Katz. Key Challenges Discussed: Data Interpretation and Standardization: - Harmonizing diverse data types for consistent interpretation across different genomic platforms. - Developing standardized guidelines for interpreting genomic data in the clinical context. Infrastructure and Resources: - The need for robust computational infrastructure to handle large-scale genomic data. - Ensuring access to necessary resources and funding for ongoing genomic initiatives. Clinical Utility and Integration: - Demonstrating... Read more at https://happykhan.com/microbinfie/mb-76-what-are-the-major-challenges-for-getting-amr-genomics-into-the-clinic tag:soundcloud,2010:tracks/1128163150 https://soundcloud.com/microbinfie/sepia-with-henk-soup-or-salad-yes Thu, 03 Feb 2022 05:00:05 GMT 00:37:36 Microbial Bioinformatics no 74 SEPIA With Henk - Soup Or Salad Yes! by Micro… In this episode of the microbinfie podcast, Dr. Henk den Bakker discusses Sepia, a novel read classification tool developed in Rust for taxonomic analysis and metagenomics research. Key Points Sepia Software Development A read classifier designed to address limitations in existing taxonomic tools Implemented in Rust for high-performance computational efficiency Uses complex hash tables and advanced data structures for sequence classification Technical Innovations Supports k-mers up to 64 base pairs Includes a batch processing mode for efficient multi-sample analysis Provides a 'hit ratio' metric for assessing read classification confidence Research Applications Used in metagenomics projects tracking animal intrusion in farmlands Applied to microbiome mapping in food safety environments Capable of quickly processing 16S datasets and identifying specific reads Take-Home Messages Rust enables significant performance improvements in bioinformatics tools Taxonomic classification requires nuanced approaches to handle complex microbial data Computational tools like Sepia can provide rapid insights across diverse research contexts In this episode of the microbinfie podcast, Dr. Henk den Bakker discusses Sepia, a novel read classification tool developed in Rust for taxonomic analysis and metagenomics research. Key Points Sepia Software Development A read classifier designed to address limitations in existing taxonomic tools Implemented in Rust for high-performance computational efficiency Uses complex hash tables and advanced data structures for sequence classification Technical Innovations Supports k-mers up to 64 base pairs Includes a batch processing mode for efficient multi-sample analysis Provides a 'hit ratio' metric for assessing read classification confidence Research Applications Used in metagenomics projects tracking animal intrusion in farmlands Applied to microbiome mapping in food safety environments Capable of quickly processing 16S datasets and identifying specific reads Take-Home Messages Rust enables significant performance improvements in bioinformatics tools Taxonomic classification requires nuanced approaches to handle complex microbial data Computational tools like Sepia can provide rapid insights across diverse research contexts tag:soundcloud,2010:tracks/1131859324 https://soundcloud.com/microbinfie/bactopia-part-2 Thu, 20 Jan 2022 02:00:08 GMT 00:28:35 Microbial Bioinformatics no We are again joined by Dr Robert Petit from the W… We are joined once again by Dr. Robert Petit from the Wyoming Public Health Laboratory. Today, Dr. Petit is discussing BACTOPIA, a bioinformatics workflow designed specifically for analyzing bacterial genomes. Overview of BACTOPIA BACTOPIA is a comprehensive tool that facilitates the processing and analysis of bacterial genome data. It is designed to cater to a range of needs from researchers working in bacterial genomics, providing an efficient and streamlined workflow. Key Features of BACTOPIA Designed specifically for bacterial genomes Provides an efficient workflow for data analysis Supports a variety of genomics research needs Resources Documentation: BACTOPIA Docs GitHub Repository: BACTOPIA Repo Published Article: mSystems Publication For those interested in diving deeper into the tool, these resources provide comprehensive information and access to both the software itself and its supporting documentation. Whether you're a seasoned bioinformatician or new to bacterial genome analysis, BACTOPIA offers the tools you need to advance your... Read more at https://happykhan.com/microbinfie/mb-73-bactopia-and-using-workflow-managers-in-bioinformatics-part-2 We are joined once again by Dr. Robert Petit from the Wyoming Public Health Laboratory. Today, Dr. Petit is discussing BACTOPIA, a bioinformatics workflow designed specifically for analyzing bacterial genomes. Overview of BACTOPIA BACTOPIA is a comprehensive tool that facilitates the processing and analysis of bacterial genome data. It is designed to cater to a range of needs from researchers working in bacterial genomics, providing an efficient and streamlined workflow. Key Features of BACTOPIA Designed specifically for bacterial genomes Provides an efficient workflow for data analysis Supports a variety of genomics research needs Resources Documentation: BACTOPIA Docs GitHub Repository: BACTOPIA Repo Published Article: mSystems Publication For those interested in diving deeper into the tool, these resources provide comprehensive information and access to both the software itself and its supporting documentation. Whether you're a seasoned bioinformatician or new to bacterial genome analysis, BACTOPIA offers the tools you need to advance your... Read more at https://happykhan.com/microbinfie/mb-73-bactopia-and-using-workflow-managers-in-bioinformatics-part-2 tag:soundcloud,2010:tracks/1131828346 https://soundcloud.com/microbinfie/bactopia-part-1 Thu, 06 Jan 2022 02:00:02 GMT 00:35:10 Microbial Bioinformatics no We are joined by Dr Robert Petit from the Wyoming… We are joined by Dr. Robert Petit from the Wyoming Public Health Laboratory, who is here to discuss BACTOPIA, a bioinformatics workflow specifically designed for bacterial genomes. Resources Documentation: Bactopia Documentation Repository: GitHub - Bactopia Publication: BACTOPIA in mSystems Key Points Workflow Development Journey Started with Staphopia, a workflow specifically for Staphylococcus aureus genomes Evolved through multiple iterations using different programming languages and workflow managers Transitioned from web-based platform to a flexible, generalized bacterial genome analysis tool Bactopia's Core Purpose Provides an all-in-one workflow for complete bacterial genome analysis Designed to help researchers quickly access analytical results Simplifies complex bioinformatics processes for researchers with varying technical expertise Technological Evolution Reflects the rapid changes in bioinformatics tools and approaches Incorporated modern practices like containerization and workflow management Demonstrates the iterative nature of scientific software development Take-Home Messages Bactopia simplifies bacterial genome analysis for researchers Continuous software refinement is crucial in bioinformatics... Read more at https://happykhan.com/microbinfie/mb-72-bactopia-and-using-workflow-managers-in-bioinformatics-part-1 We are joined by Dr. Robert Petit from the Wyoming Public Health Laboratory, who is here to discuss BACTOPIA, a bioinformatics workflow specifically designed for bacterial genomes. Resources Documentation: Bactopia Documentation Repository: GitHub - Bactopia Publication: BACTOPIA in mSystems Key Points Workflow Development Journey Started with Staphopia, a workflow specifically for Staphylococcus aureus genomes Evolved through multiple iterations using different programming languages and workflow managers Transitioned from web-based platform to a flexible, generalized bacterial genome analysis tool Bactopia's Core Purpose Provides an all-in-one workflow for complete bacterial genome analysis Designed to help researchers quickly access analytical results Simplifies complex bioinformatics processes for researchers with varying technical expertise Technological Evolution Reflects the rapid changes in bioinformatics tools and approaches Incorporated modern practices like containerization and workflow management Demonstrates the iterative nature of scientific software development Take-Home Messages Bactopia simplifies bacterial genome analysis for researchers Continuous software refinement is crucial in bioinformatics... Read more at https://happykhan.com/microbinfie/mb-72-bactopia-and-using-workflow-managers-in-bioinformatics-part-1 tag:soundcloud,2010:tracks/1179597649 https://soundcloud.com/microbinfie/bacterial-taxonomy-into-the-unknown-seqcode-naming-uncultured-multitudes-and-renaming-of-phyla Fri, 17 Dec 2021 12:45:45 GMT 00:40:59 Microbial Bioinformatics no We finish our discussion on bacterial taxonomy, t… The microbinfie podcast explores the intricate world of bacterial naming conventions and taxonomy, diving deep into the challenges of classifying and naming microbial species in the modern scientific landscape. In our latest discussion on bacterial taxonomy, we explore the innovative methods for naming the multitude of unnamed, uncultured organisms as well as the contentious issue of renaming phyla. This discussion focuses on modern approaches in the taxonomy of bacteria, particularly on the challenges and methodologies involved in classifying unnamed and uncultured organisms. Additionally, we delve into the ongoing debate over the renaming of bacterial phyla, examining both the scientific and practical implications. Key Topics Discussed: Naming Uncultured Organisms: - Techniques and rationale behind naming bacteria that have not been cultured. Renaming of Phyla: - The reasons for and against the renaming of established phyla. - Insights into the controversies within the scientific community. Methodologies: - An exploration of the techniques... Read more at https://happykhan.com/microbinfie/mb-71-bacterial-taxonomy-into-the-unknown-seqcode-naming-uncultured-multitudes-and-renaming-of-phyla The microbinfie podcast explores the intricate world of bacterial naming conventions and taxonomy, diving deep into the challenges of classifying and naming microbial species in the modern scientific landscape. In our latest discussion on bacterial taxonomy, we explore the innovative methods for naming the multitude of unnamed, uncultured organisms as well as the contentious issue of renaming phyla. This discussion focuses on modern approaches in the taxonomy of bacteria, particularly on the challenges and methodologies involved in classifying unnamed and uncultured organisms. Additionally, we delve into the ongoing debate over the renaming of bacterial phyla, examining both the scientific and practical implications. Key Topics Discussed: Naming Uncultured Organisms: - Techniques and rationale behind naming bacteria that have not been cultured. Renaming of Phyla: - The reasons for and against the renaming of established phyla. - Insights into the controversies within the scientific community. Methodologies: - An exploration of the techniques... Read more at https://happykhan.com/microbinfie/mb-71-bacterial-taxonomy-into-the-unknown-seqcode-naming-uncultured-multitudes-and-renaming-of-phyla tag:soundcloud,2010:tracks/1178880226 https://soundcloud.com/microbinfie/bacterial-taxonomy-the-grand-vista-is-ahead-of-us Fri, 17 Dec 2021 05:01:40 GMT 00:28:40 Microbial Bioinformatics no We continue our discussion on bacterial taxonomy,… The microbinfie podcast explores the transformative impact of genomics on bacterial taxonomy, featuring expert insights into how modern molecular techniques are revolutionizing our understanding of bacterial classification and evolutionary relationships. Discussion Highlights Genomics has significantly altered the framework of bacterial taxonomy by: Refining Phylogenetic Relationships: Genomics allows for more precise phylogenetic trees based on DNA sequences rather than solely on phenotypic characteristics. Discovering New Lineages: The ability to sequence genomes quickly and affordably has led to the discovery of previously unknown bacterial lineages. Clarifying Species Concepts: Genomic data has helped clarify what constitutes a bacterial species, challenging many traditional concepts. Key Points Genomic Taxonomy Approaches Genome Taxonomy Database (GTTB) represents a comprehensive genomic approach to bacterial classification Uses 120 single-copy conserved genes for phylogenetic tree construction Employs relative evolutionary divergence to assign taxonomic ranks Taxonomic Challenges and Discoveries Traditional classification methods are being challenged by molecular techniques Examples like Mycoplasma... Read more at https://happykhan.com/microbinfie/mb-70-bacterial-taxonomy-the-grand-vista-is-ahead-of-us The microbinfie podcast explores the transformative impact of genomics on bacterial taxonomy, featuring expert insights into how modern molecular techniques are revolutionizing our understanding of bacterial classification and evolutionary relationships. Discussion Highlights Genomics has significantly altered the framework of bacterial taxonomy by: Refining Phylogenetic Relationships: Genomics allows for more precise phylogenetic trees based on DNA sequences rather than solely on phenotypic characteristics. Discovering New Lineages: The ability to sequence genomes quickly and affordably has led to the discovery of previously unknown bacterial lineages. Clarifying Species Concepts: Genomic data has helped clarify what constitutes a bacterial species, challenging many traditional concepts. Key Points Genomic Taxonomy Approaches Genome Taxonomy Database (GTTB) represents a comprehensive genomic approach to bacterial classification Uses 120 single-copy conserved genes for phylogenetic tree construction Employs relative evolutionary divergence to assign taxonomic ranks Taxonomic Challenges and Discoveries Traditional classification methods are being challenged by molecular techniques Examples like Mycoplasma... Read more at https://happykhan.com/microbinfie/mb-70-bacterial-taxonomy-the-grand-vista-is-ahead-of-us tag:soundcloud,2010:tracks/1178439874 https://soundcloud.com/microbinfie/69-background-to-bacterial-taxonomy Thu, 16 Dec 2021 05:00:30 GMT 00:26:29 Microbial Bioinformatics no There has been a lot of discussion about bacteria… The microbinfie podcast explores the intricate world of bacterial taxonomy, tracing its historical development and philosophical foundations through conversations with leading experts in microbial systematics. The discussion aims to clarify the fundamental aspects of bacterial taxonomy, a critical area for understanding microbial diversity, ecological roles, and evolutionary relationships. Changes in classification often stem from advancements in genetic and genomic analyses, leading to shifts in the understanding of bacterial phylogenetics. Bacterial taxonomy continues to evolve as scientific techniques advance, offering nuanced insights into microbial ecosystems. Engaging with experts in the field helps demystify complex changes and encourages informed discussions about the broader implications of taxonomic reclassifications. Key Contributors: Professor Phil Hugenholtz: An expert in microbial ecology and evolution, contributing significant insights into microbial diversity and taxonomy. Professor Iain Sutcliffe: Known for his work on bacterial systematics and the broader impact of taxonomy changes on related scientific fields. Professor Mark Pallen: Focuses... Read more at https://happykhan.com/microbinfie/mb-69-background-to-bacterial-taxonomy The microbinfie podcast explores the intricate world of bacterial taxonomy, tracing its historical development and philosophical foundations through conversations with leading experts in microbial systematics. The discussion aims to clarify the fundamental aspects of bacterial taxonomy, a critical area for understanding microbial diversity, ecological roles, and evolutionary relationships. Changes in classification often stem from advancements in genetic and genomic analyses, leading to shifts in the understanding of bacterial phylogenetics. Bacterial taxonomy continues to evolve as scientific techniques advance, offering nuanced insights into microbial ecosystems. Engaging with experts in the field helps demystify complex changes and encourages informed discussions about the broader implications of taxonomic reclassifications. Key Contributors: Professor Phil Hugenholtz: An expert in microbial ecology and evolution, contributing significant insights into microbial diversity and taxonomy. Professor Iain Sutcliffe: Known for his work on bacterial systematics and the broader impact of taxonomy changes on related scientific fields. Professor Mark Pallen: Focuses... Read more at https://happykhan.com/microbinfie/mb-69-background-to-bacterial-taxonomy tag:soundcloud,2010:tracks/1132643266 https://soundcloud.com/microbinfie/whats-in-a-name-part-2 Thu, 09 Dec 2021 02:00:02 GMT 00:40:54 Microbial Bioinformatics no 68 Bacterial Taxonomy: what is a species, what i… The microbinfie podcast explores the evolving landscape of bacterial taxonomy, focusing on genomic approaches to classifying microorganisms and the challenges of traditional taxonomic systems. Bacterial taxonomy involves the classification and naming of bacteria, which is essential for understanding the relationships and functions of microorganisms in various environments. This second part of the series further explores the concepts of species and strains in bacterial taxonomy. Bacterial Species A species in bacterial taxonomy is a fundamental unit used to categorize and distinguish between different bacteria. Traditionally, species classification was based on phenotypic characteristics like morphology, metabolism, and chemical composition. However, modern approaches rely heavily on genetic analysis. Key points include: Genetic Similarity: A bacterial species is often defined by a high degree of genetic similarity, usually assessed through DNA sequence analysis. Techniques such as 16S rRNA gene sequencing are commonly used. Biological Relevance: Species classification reflects the biological relevance and ecological niche... Read more at https://happykhan.com/microbinfie/mb-68-bacterial-taxonomy-what-is-a-species-what-is-a-strain-part-2 The microbinfie podcast explores the evolving landscape of bacterial taxonomy, focusing on genomic approaches to classifying microorganisms and the challenges of traditional taxonomic systems. Bacterial taxonomy involves the classification and naming of bacteria, which is essential for understanding the relationships and functions of microorganisms in various environments. This second part of the series further explores the concepts of species and strains in bacterial taxonomy. Bacterial Species A species in bacterial taxonomy is a fundamental unit used to categorize and distinguish between different bacteria. Traditionally, species classification was based on phenotypic characteristics like morphology, metabolism, and chemical composition. However, modern approaches rely heavily on genetic analysis. Key points include: Genetic Similarity: A bacterial species is often defined by a high degree of genetic similarity, usually assessed through DNA sequence analysis. Techniques such as 16S rRNA gene sequencing are commonly used. Biological Relevance: Species classification reflects the biological relevance and ecological niche... Read more at https://happykhan.com/microbinfie/mb-68-bacterial-taxonomy-what-is-a-species-what-is-a-strain-part-2 tag:soundcloud,2010:tracks/1132135213 https://soundcloud.com/microbinfie/whats-in-a-name-part-1 Thu, 25 Nov 2021 03:00:09 GMT 00:25:25 Microbial Bioinformatics no We’re navigating the twisted world of bacterial t… The microbinfie podcast explores the complex world of bacterial taxonomy, delving into the challenges of defining species and classification in microbial systems with two expert guests. Key Points Bacterial Species Concept Traditional species definition relies on biochemical tests and phenotypic characteristics 16S rRNA sequencing has been a primary method for taxonomic classification Modern approaches increasingly use genomic methods like Average Nucleotide Identity (ANI) Taxonomic Challenges No single universal species concept exists across all organisms Prokaryotic classification differs significantly from multicellular organism classification Genetic material exchange and discontinuity are key considerations in defining species Emerging Taxonomic Methods Whole genome sequencing is becoming preferred for bacterial classification Metagenomic data presents significant challenges for traditional taxonomic approaches Historical classification methods continue to influence modern taxonomic practices Take-Home Messages Bacterial taxonomy is a complex and evolving field Genomic methods are progressively replacing traditional classification techniques Philosophical and practical considerations are crucial in defining microbial... Read more at https://happykhan.com/microbinfie/mb-67-bacterial-taxonomy-what-is-a-species-what-is-a-strain The microbinfie podcast explores the complex world of bacterial taxonomy, delving into the challenges of defining species and classification in microbial systems with two expert guests. Key Points Bacterial Species Concept Traditional species definition relies on biochemical tests and phenotypic characteristics 16S rRNA sequencing has been a primary method for taxonomic classification Modern approaches increasingly use genomic methods like Average Nucleotide Identity (ANI) Taxonomic Challenges No single universal species concept exists across all organisms Prokaryotic classification differs significantly from multicellular organism classification Genetic material exchange and discontinuity are key considerations in defining species Emerging Taxonomic Methods Whole genome sequencing is becoming preferred for bacterial classification Metagenomic data presents significant challenges for traditional taxonomic approaches Historical classification methods continue to influence modern taxonomic practices Take-Home Messages Bacterial taxonomy is a complex and evolving field Genomic methods are progressively replacing traditional classification techniques Philosophical and practical considerations are crucial in defining microbial... Read more at https://happykhan.com/microbinfie/mb-67-bacterial-taxonomy-what-is-a-species-what-is-a-strain tag:soundcloud,2010:tracks/1108185769 https://soundcloud.com/microbinfie/66-scholarly-communications-for-bioinformaticians Thu, 18 Nov 2021 02:00:01 GMT 00:44:52 Microbial Bioinformatics no Have you ever read a paper and wondered why the a… The microbinfie podcast explores strategies for researchers to develop an effective online presence and communicate scientific work more effectively in the digital age. Have you ever read a paper and wondered why the author buried their key result on page 39 of a 50-page paper? Bioinformaticians often struggle with effectively communicating their findings to a broader audience. This article discusses ways to enhance communication specifically for bioinformaticians. Improving communication can lead to better recognition and collaboration within the scientific community, especially in technical fields like bioinformatics. Consider these tips to enhance your scholarly outreach. Key Topics Online Presence & Scholarly Communications for Bioinformatics - Utilizing platforms like Google Scholar and Scopus - Effective marketing to peers - Importance of organization websites Managing Your Publication Record - Leveraging citation metrics and collaborating with librarians Peer Review and Social Media - Engaging in peer review - Using platforms such as Twitter and... Read more at https://happykhan.com/microbinfie/mb-66-scholarly-communications-for-bioinformaticians The microbinfie podcast explores strategies for researchers to develop an effective online presence and communicate scientific work more effectively in the digital age. Have you ever read a paper and wondered why the author buried their key result on page 39 of a 50-page paper? Bioinformaticians often struggle with effectively communicating their findings to a broader audience. This article discusses ways to enhance communication specifically for bioinformaticians. Improving communication can lead to better recognition and collaboration within the scientific community, especially in technical fields like bioinformatics. Consider these tips to enhance your scholarly outreach. Key Topics Online Presence & Scholarly Communications for Bioinformatics - Utilizing platforms like Google Scholar and Scopus - Effective marketing to peers - Importance of organization websites Managing Your Publication Record - Leveraging citation metrics and collaborating with librarians Peer Review and Social Media - Engaging in peer review - Using platforms such as Twitter and... Read more at https://happykhan.com/microbinfie/mb-66-scholarly-communications-for-bioinformaticians tag:soundcloud,2010:tracks/1108394260 https://soundcloud.com/microbinfie/how-to-review-a-bioinformatics-paper-in-10-days-or-less Tue, 02 Nov 2021 16:48:54 GMT 00:31:12 Microbial Bioinformatics no We discuss how to effectively review bioinformati… The microbinfie podcast explores the complex and nuanced world of peer review in bioinformatics research, offering candid insights into how researchers efficiently evaluate scientific manuscripts. When tasked with reviewing bioinformatics or microbial genomics papers, it’s important to focus on several core aspects to ensure the research is robust, well-documented, and impactful. Relevance and Novelty - Assess the significance and novelty of the research question. - Determine whether the study contributes new insights to the field of bioinformatics or microbial genomics. Methodological Rigor - Ensure that the methodologies and computational techniques used are appropriate and clearly described. - Evaluate whether the authors have used state-of-the-art approaches and adequately benchmarked new methods against existing ones. - Check for proper validation of in silico results with experimental data if applicable. Data and Code Availability - Confirm that raw data and computational codes are publicly available and accessible. - The authors should provide clear... Read more at https://happykhan.com/microbinfie/mb-75-how-to-review-a-bioinformatics-paper-in-10-days-or-less The microbinfie podcast explores the complex and nuanced world of peer review in bioinformatics research, offering candid insights into how researchers efficiently evaluate scientific manuscripts. When tasked with reviewing bioinformatics or microbial genomics papers, it’s important to focus on several core aspects to ensure the research is robust, well-documented, and impactful. Relevance and Novelty - Assess the significance and novelty of the research question. - Determine whether the study contributes new insights to the field of bioinformatics or microbial genomics. Methodological Rigor - Ensure that the methodologies and computational techniques used are appropriate and clearly described. - Evaluate whether the authors have used state-of-the-art approaches and adequately benchmarked new methods against existing ones. - Check for proper validation of in silico results with experimental data if applicable. Data and Code Availability - Confirm that raw data and computational codes are publicly available and accessible. - The authors should provide clear... Read more at https://happykhan.com/microbinfie/mb-75-how-to-review-a-bioinformatics-paper-in-10-days-or-less tag:soundcloud,2010:tracks/1095637423 https://soundcloud.com/microbinfie/65-genomics-of-mycobacterium-tuberculosis Thu, 28 Oct 2021 04:00:04 GMT 00:33:54 Microbial Bioinformatics no We’re continuing our series where we examine a pa… The microbinfie podcast explores the complex world of Mycobacterium tuberculosis genomics, discussing cutting-edge bioinformatics tools, evolutionary dynamics, and challenges in studying this challenging pathogen. Guest Experts Dr. Suzie Hingley-Wilson Lecturer in Bacteriology at the University of Surrey Dr. Dany Beste Senior Lecturer in Microbial Metabolism at the University of Surrey Dr. Conor Meehan Assistant Professor in Molecular Microbiology at the University of Bradford Discussion Highlights Join us as we explore the fascinating world of Mycobacterium tuberculosis through the lens of expert insights in bioinformatics, genomics, and typing. Stay tuned for more in-depth analyses and discussions with leading experts in the field! Key Points Bioinformatics Tools for TB Emerging tools like GalRoo enable polygotyping on long-read sequencing Transitioning from short-read to long-read bioinformatics approaches Standardization of variant calling and tool specifications critical Genomic Diversity and Evolution TB has multiple lineages (currently known as lineages 1-9) Mutation rates around 10^-6 to 10^-7... Read more at https://happykhan.com/microbinfie/mb-65-genomics-of-mycobacterium-tuberculosis The microbinfie podcast explores the complex world of Mycobacterium tuberculosis genomics, discussing cutting-edge bioinformatics tools, evolutionary dynamics, and challenges in studying this challenging pathogen. Guest Experts Dr. Suzie Hingley-Wilson Lecturer in Bacteriology at the University of Surrey Dr. Dany Beste Senior Lecturer in Microbial Metabolism at the University of Surrey Dr. Conor Meehan Assistant Professor in Molecular Microbiology at the University of Bradford Discussion Highlights Join us as we explore the fascinating world of Mycobacterium tuberculosis through the lens of expert insights in bioinformatics, genomics, and typing. Stay tuned for more in-depth analyses and discussions with leading experts in the field! Key Points Bioinformatics Tools for TB Emerging tools like GalRoo enable polygotyping on long-read sequencing Transitioning from short-read to long-read bioinformatics approaches Standardization of variant calling and tool specifications critical Genomic Diversity and Evolution TB has multiple lineages (currently known as lineages 1-9) Mutation rates around 10^-6 to 10^-7... Read more at https://happykhan.com/microbinfie/mb-65-genomics-of-mycobacterium-tuberculosis tag:soundcloud,2010:tracks/1086608620 https://soundcloud.com/microbinfie/64-mycobacterium-tuberculosis-the-forgotten-pandemic Thu, 14 Oct 2021 04:00:07 GMT 00:36:24 Microbial Bioinformatics no We’re continuing our series where we examine a pa… The microbinfie podcast explores the complex world of Mycobacterium tuberculosis (MTB), revealing the ongoing global health challenge of tuberculosis and its intricate genomic and epidemiological characteristics. Welcome back to our series where we explore specific microbial species in detail. Today, we're focusing on Mycobacterium tuberculosis, often referred to as the "forgotten pandemic." Our distinguished guests for this discussion are: Dr. Suzie Hingley-Wilson, Lecturer in Bacteriology at the University of Surrey Dr. Dany Beste, Senior Lecturer in Microbial Metabolism at the University of Surrey Dr. Conor Meehan, Assistant Professor in Molecular Microbiology at the University of Bradford Key Points Global TB Epidemiology TB remains a leading cause of infectious death, with approximately 10 million cases annually About 1.5 million deaths occur each year, with 500-600,000 cases being drug-resistant COVID-19 pandemic has significantly impacted TB diagnosis and treatment Vaccine and Treatment Challenges BCG vaccine effectiveness varies globally, with protection ranging from less... Read more at https://happykhan.com/microbinfie/mb-64-mycobacterium-tuberculosis-the-forgotten-pandemic The microbinfie podcast explores the complex world of Mycobacterium tuberculosis (MTB), revealing the ongoing global health challenge of tuberculosis and its intricate genomic and epidemiological characteristics. Welcome back to our series where we explore specific microbial species in detail. Today, we're focusing on Mycobacterium tuberculosis, often referred to as the "forgotten pandemic." Our distinguished guests for this discussion are: Dr. Suzie Hingley-Wilson, Lecturer in Bacteriology at the University of Surrey Dr. Dany Beste, Senior Lecturer in Microbial Metabolism at the University of Surrey Dr. Conor Meehan, Assistant Professor in Molecular Microbiology at the University of Bradford Key Points Global TB Epidemiology TB remains a leading cause of infectious death, with approximately 10 million cases annually About 1.5 million deaths occur each year, with 500-600,000 cases being drug-resistant COVID-19 pandemic has significantly impacted TB diagnosis and treatment Vaccine and Treatment Challenges BCG vaccine effectiveness varies globally, with protection ranging from less... Read more at https://happykhan.com/microbinfie/mb-64-mycobacterium-tuberculosis-the-forgotten-pandemic tag:soundcloud,2010:tracks/1080404938 https://soundcloud.com/microbinfie/63-a-dive-into-campylobacter-genomics Thu, 30 Sep 2021 03:00:06 GMT 00:33:57 Microbial Bioinformatics no Our guest today is Dr Ozan Gundogdu for a deeper … In this episode of the microbinfie podcast, Dr. Ozan Gundogdu provides an in-depth exploration of Campylobacter genomics, revealing the complex genetic landscape of this important foodborne pathogen. Our guest today is Dr. Ozan Gundogdu, here for a deeper dive into the foodborne pathogen Campylobacter and how genomics has informed the field over the past 20 years since the publication of the first reference genome in 1999. Dr. Gundogdu leads the foodborne enteric pathogen group at the London School of Hygiene & Tropical Medicine, where they study the physiology and pathogenesis of Campylobacter and other related enteric microorganisms like Listeria and Vibrio. Dr. Gundogdu's background is in molecular biology and computer science, and he completed his PhD at LSHTM (London School of Hygiene & Tropical Medicine) in 2011. For more information, you can visit his profile here. Key Points Campylobacter Genome Characteristics First genome sequenced in 1999 (strain NCTC1116A) Small genome... Read more at https://happykhan.com/microbinfie/mb-63-a-dive-into-campylobacter-genomics In this episode of the microbinfie podcast, Dr. Ozan Gundogdu provides an in-depth exploration of Campylobacter genomics, revealing the complex genetic landscape of this important foodborne pathogen. Our guest today is Dr. Ozan Gundogdu, here for a deeper dive into the foodborne pathogen Campylobacter and how genomics has informed the field over the past 20 years since the publication of the first reference genome in 1999. Dr. Gundogdu leads the foodborne enteric pathogen group at the London School of Hygiene & Tropical Medicine, where they study the physiology and pathogenesis of Campylobacter and other related enteric microorganisms like Listeria and Vibrio. Dr. Gundogdu's background is in molecular biology and computer science, and he completed his PhD at LSHTM (London School of Hygiene & Tropical Medicine) in 2011. For more information, you can visit his profile here. Key Points Campylobacter Genome Characteristics First genome sequenced in 1999 (strain NCTC1116A) Small genome... Read more at https://happykhan.com/microbinfie/mb-63-a-dive-into-campylobacter-genomics tag:soundcloud,2010:tracks/1080239050 https://soundcloud.com/microbinfie/62-campylobacter-the-fussy-little-pathogen Thu, 16 Sep 2021 03:00:06 GMT 00:21:42 Microbial Bioinformatics no Our guest today is Dr Ozan Gundogdu and he gives … The microbinfie podcast explores Campylobacter, a complex foodborne pathogen, with insights from Dr. Ozan Gundogdu on its unique biological characteristics, transmission dynamics, and research challenges. Today, we have the pleasure of hosting Dr. Ozan Gundogdu, who provides us with a crash course on the foodborne pathogen Campylobacter. If you've ever experienced stomach issues after consuming undercooked chicken, Campylobacter is likely the culprit. Dr. Gundogdu leads the Foodborne Enteric Pathogen Group at the London School of Hygiene and Tropical Medicine, where they focus on the physiology and pathogenesis of Campylobacter and other related enteric microorganisms, such as Listeria and Vibrio. Dr. Gundogdu's academic background is in Molecular Biology and Computer Science. He completed his PhD at the London School of Hygiene & Tropical Medicine (LSHTM) in 2011. For more information, you can visit Dr. Gundogdu's profile at LSHTM. Extra notes Dr. Ozan Gongadou, a specialist in microbiology and computer science, focuses... Read more at https://happykhan.com/microbinfie/mb-62-campylobacter-the-fussy-little-pathogen The microbinfie podcast explores Campylobacter, a complex foodborne pathogen, with insights from Dr. Ozan Gundogdu on its unique biological characteristics, transmission dynamics, and research challenges. Today, we have the pleasure of hosting Dr. Ozan Gundogdu, who provides us with a crash course on the foodborne pathogen Campylobacter. If you've ever experienced stomach issues after consuming undercooked chicken, Campylobacter is likely the culprit. Dr. Gundogdu leads the Foodborne Enteric Pathogen Group at the London School of Hygiene and Tropical Medicine, where they focus on the physiology and pathogenesis of Campylobacter and other related enteric microorganisms, such as Listeria and Vibrio. Dr. Gundogdu's academic background is in Molecular Biology and Computer Science. He completed his PhD at the London School of Hygiene & Tropical Medicine (LSHTM) in 2011. For more information, you can visit Dr. Gundogdu's profile at LSHTM. Extra notes Dr. Ozan Gongadou, a specialist in microbiology and computer science, focuses... Read more at https://happykhan.com/microbinfie/mb-62-campylobacter-the-fussy-little-pathogen tag:soundcloud,2010:tracks/1080802513 https://soundcloud.com/microbinfie/61-non-fungible-tokens-you-too-can-own-brca1 Thu, 02 Sep 2021 04:00:05 GMT 00:28:25 Microbial Bioinformatics no We look at the crazy world of NFTs (non fungible … In this episode of the microbinfie podcast, the hosts explore the fascinating world of non-fungible tokens (NFTs) and their potential applications in genomics, blockchain technology, and scientific data management. In this piece, we delve into the intriguing world of NFTs (non-fungible tokens) and blockchain technology, examining in a light-hearted fashion how these could revolutionize the fields of genomics and bioinformatics. We even suggest a radical idea: replacing all central genome databases with our envisioned cryptocurrency, either BioBucks or perhaps GenomeCoin. The Advent of NFTs and Blockchain in Genomics NFTs have taken the digital world by storm, providing a unique avenue for owning and trading digital assets. The potential application of blockchain and NFTs in genomics could enable secure, verifiable, and decentralized storage and transaction of genomic data. This approach might not only safeguard personal information but also enhance the efficiency of genomic data sharing across the scientific community. Legal and... Read more at https://happykhan.com/microbinfie/mb-61-non-fungible-tokens-you-too-can-own-brca1 In this episode of the microbinfie podcast, the hosts explore the fascinating world of non-fungible tokens (NFTs) and their potential applications in genomics, blockchain technology, and scientific data management. In this piece, we delve into the intriguing world of NFTs (non-fungible tokens) and blockchain technology, examining in a light-hearted fashion how these could revolutionize the fields of genomics and bioinformatics. We even suggest a radical idea: replacing all central genome databases with our envisioned cryptocurrency, either BioBucks or perhaps GenomeCoin. The Advent of NFTs and Blockchain in Genomics NFTs have taken the digital world by storm, providing a unique avenue for owning and trading digital assets. The potential application of blockchain and NFTs in genomics could enable secure, verifiable, and decentralized storage and transaction of genomic data. This approach might not only safeguard personal information but also enhance the efficiency of genomic data sharing across the scientific community. Legal and... Read more at https://happykhan.com/microbinfie/mb-61-non-fungible-tokens-you-too-can-own-brca1 tag:soundcloud,2010:tracks/1078225456 https://soundcloud.com/microbinfie/encore-06-what-software-not-to-write Thu, 01 Jul 2021 04:00:10 GMT 00:43:45 Microbial Bioinformatics no Torsten Seemann joins us to discuss how to write … Torsten Seemann joins us to discuss how to write good bioinformatics software. Torsten is the author of many popular bioinformatics tools such as Prokka, Snippy, Barrnap, Abricate, Shovill, and Nullarbor. Links: https://github.com/tseemann Torsten Seemann joins us to discuss how to write good bioinformatics software. Torsten is the author of many popular bioinformatics tools such as Prokka, Snippy, Barrnap, Abricate, Shovill, and Nullarbor. Links: https://github.com/tseemann tag:soundcloud,2010:tracks/1069995670 https://soundcloud.com/microbinfie/60-whats-in-a-name-salmonella-and-e-coli Thu, 17 Jun 2021 04:00:33 GMT 00:28:56 Microbial Bioinformatics no Today we’re talking about getting your head aroun… In this episode of the microbinfie podcast, the hosts dive deep into the complex world of enteric microbes, exploring the nuanced nomenclature and genomic characteristics of E. coli and Salmonella. Today, we're diving into the world of some of our favorite enteric microbes: Escherichia coli (E. coli) and Salmonella. These bacteria play significant roles in microbiology, and understanding their naming conventions can help in grasping their complexities. Why the Names? Escherichia coli The name Escherichia coli honors Theodor Escherich, the Austrian pediatrician and bacteriologist who discovered it. The abbreviation "E. coli" is commonly used in scientific literature and discussions. Salmonella Salmonella was named after Daniel Elmer Salmon, an American veterinary pathologist. This genus is known for its vast serovar diversity, classified under the Kauffman–White classification scheme. For more detailed information on Salmonella serovars, you can refer to the Wikipedia page on Kauffman–White classification. Primer on ANI (Average Nucleotide Identity) Understanding... Read more at https://happykhan.com/microbinfie/mb-60-whats-in-a-name-salmonella-and-e-coli In this episode of the microbinfie podcast, the hosts dive deep into the complex world of enteric microbes, exploring the nuanced nomenclature and genomic characteristics of E. coli and Salmonella. Today, we're diving into the world of some of our favorite enteric microbes: Escherichia coli (E. coli) and Salmonella. These bacteria play significant roles in microbiology, and understanding their naming conventions can help in grasping their complexities. Why the Names? Escherichia coli The name Escherichia coli honors Theodor Escherich, the Austrian pediatrician and bacteriologist who discovered it. The abbreviation "E. coli" is commonly used in scientific literature and discussions. Salmonella Salmonella was named after Daniel Elmer Salmon, an American veterinary pathologist. This genus is known for its vast serovar diversity, classified under the Kauffman–White classification scheme. For more detailed information on Salmonella serovars, you can refer to the Wikipedia page on Kauffman–White classification. Primer on ANI (Average Nucleotide Identity) Understanding... Read more at https://happykhan.com/microbinfie/mb-60-whats-in-a-name-salmonella-and-e-coli tag:soundcloud,2010:tracks/1058700748 https://soundcloud.com/microbinfie/59a-microbe-moment-micro-binfie Thu, 03 Jun 2021 17:28:10 GMT 00:13:18 Microbial Bioinformatics no Andrew, Nabil, and Lee answer the Microbigal's qu… In this engaging episode of the microbinfie podcast, hosts Andrew, Nabil, and Lee dive deep into the fascinating world of microbial bioinformatics, sharing personal experiences, favorite microbes, and intriguing insights into genomics and microbial research. Microbe Moment is a segment where Andrew, Nabil, and Lee answer intriguing questions brought to you by the Microbigals. For more information and to explore more microbial content, visit the Microbigals website at www.microbigals.com. In these sessions, they delve into various topics about the vast and fascinating world of microbes, offering insights into the role they play in ecology, human health, and beyond. Whether you are a microbial enthusiast or just curious, the Microbe Moment is a place to expand your understanding and appreciation of these microscopic organisms. Stay tuned for more engaging discussions and discover the incredible universe that exists right under our noses! Extra notes The podcast discusses various aspects of microbial bioinformatics,... Read more at https://happykhan.com/microbinfie/mb-59-microbe-moment-micro-binfie In this engaging episode of the microbinfie podcast, hosts Andrew, Nabil, and Lee dive deep into the fascinating world of microbial bioinformatics, sharing personal experiences, favorite microbes, and intriguing insights into genomics and microbial research. Microbe Moment is a segment where Andrew, Nabil, and Lee answer intriguing questions brought to you by the Microbigals. For more information and to explore more microbial content, visit the Microbigals website at www.microbigals.com. In these sessions, they delve into various topics about the vast and fascinating world of microbes, offering insights into the role they play in ecology, human health, and beyond. Whether you are a microbial enthusiast or just curious, the Microbe Moment is a place to expand your understanding and appreciation of these microscopic organisms. Stay tuned for more engaging discussions and discover the incredible universe that exists right under our noses! Extra notes The podcast discusses various aspects of microbial bioinformatics,... Read more at https://happykhan.com/microbinfie/mb-59-microbe-moment-micro-binfie tag:soundcloud,2010:tracks/1037208979 https://soundcloud.com/microbinfie/58-staph-b-careers-with-curtis-kapsak-and-kevin-libuit Fri, 21 May 2021 07:00:10 GMT 00:39:43 Microbial Bioinformatics no We dive deeper into Curtis's and Kevin's career! In this episode of the microbinfie podcast, Kevin Libuit and Curtis Kapsak share their career journeys from biology students to bioinformatics professionals, highlighting the evolving landscape of public health genomics and computational biology. Curtis's Career Curtis has been actively involved in various scientific outreach programs. One example is his participation in the Skype a Scientist initiative, which connects scientists with classrooms and groups around the world. This platform allows experts to share their research and insights with broader audiences, enriching educational experiences. Relevant Link: Skype a Scientist Kevin's Career Kevin has focused extensively on bioinformatics and genomics. He is associated with the Bioinformatics Fellowship offered by the Association of Public Health Laboratories (APHL), where he works on leveraging data science to advance public health initiatives. Relevant Link: APHL Bioinformatics Fellowship Kevin is also affiliated with the James Madison University Genomics and Biology departments, contributing to research and development in the... Read more at https://happykhan.com/microbinfie/mb-58-staph-b-careers-with-curtis-kapsak-and-kevin-libui In this episode of the microbinfie podcast, Kevin Libuit and Curtis Kapsak share their career journeys from biology students to bioinformatics professionals, highlighting the evolving landscape of public health genomics and computational biology. Curtis's Career Curtis has been actively involved in various scientific outreach programs. One example is his participation in the Skype a Scientist initiative, which connects scientists with classrooms and groups around the world. This platform allows experts to share their research and insights with broader audiences, enriching educational experiences. Relevant Link: Skype a Scientist Kevin's Career Kevin has focused extensively on bioinformatics and genomics. He is associated with the Bioinformatics Fellowship offered by the Association of Public Health Laboratories (APHL), where he works on leveraging data science to advance public health initiatives. Relevant Link: APHL Bioinformatics Fellowship Kevin is also affiliated with the James Madison University Genomics and Biology departments, contributing to research and development in the... Read more at https://happykhan.com/microbinfie/mb-58-staph-b-careers-with-curtis-kapsak-and-kevin-libui tag:soundcloud,2010:tracks/1032644443 https://soundcloud.com/microbinfie/staph-b-part-1 Fri, 07 May 2021 02:00:00 GMT 00:35:47 Microbial Bioinformatics no The crew talks to Curtis Kapsak and Kevin Libuit … In this episode of the microbinfie podcast, Kevin Libuit and Curtis Kapsak share their journey from biology students to bioinformatics professionals, highlighting the collaborative and innovative world of public health genomics. Resources: StaPH-B GitHub Repository: You can access the StaPH-B Docker builds code repository at the following link: StaPH-B GitHub. StaPH-B DockerHub: Explore the StaPH-B DockerHub container repositories here: StaPH-B DockerHub. Contribution Guide: For those interested in contributing to the project, a comprehensive guide is available: Contribute to StaPH-B. Key Points Career Transitions in Bioinformatics Both guests started on pre-med tracks before discovering a passion for research Transitioned from traditional wet lab work to computational biology Valued quick feedback loops and scalability of computational approaches Public Health Bioinformatics Fellowships Participated in APHL/CDC bioinformatics fellowship program Worked at state public health laboratories Developed skills in genomic sequencing and analysis StaPH-B Community and Collaboration Introduced to StaPH-B community during early career stages... Read more at https://happykhan.com/microbinfie/mb-57-staph-b-docker-containers-for-public-health-bioinformatics-part-1 In this episode of the microbinfie podcast, Kevin Libuit and Curtis Kapsak share their journey from biology students to bioinformatics professionals, highlighting the collaborative and innovative world of public health genomics. Resources: StaPH-B GitHub Repository: You can access the StaPH-B Docker builds code repository at the following link: StaPH-B GitHub. StaPH-B DockerHub: Explore the StaPH-B DockerHub container repositories here: StaPH-B DockerHub. Contribution Guide: For those interested in contributing to the project, a comprehensive guide is available: Contribute to StaPH-B. Key Points Career Transitions in Bioinformatics Both guests started on pre-med tracks before discovering a passion for research Transitioned from traditional wet lab work to computational biology Valued quick feedback loops and scalability of computational approaches Public Health Bioinformatics Fellowships Participated in APHL/CDC bioinformatics fellowship program Worked at state public health laboratories Developed skills in genomic sequencing and analysis StaPH-B Community and Collaboration Introduced to StaPH-B community during early career stages... Read more at https://happykhan.com/microbinfie/mb-57-staph-b-docker-containers-for-public-health-bioinformatics-part-1 tag:soundcloud,2010:tracks/1019140078 https://soundcloud.com/microbinfie/56-sars-cov-2-and-sequencing-spike-with-sanger-sequencing-welcome-to-1995 Wed, 21 Apr 2021 23:00:01 GMT 00:25:04 Microbial Bioinformatics no Part 2 going through a new method for identifying… In this segment, we explore a novel method for identifying variants of concern (VOCs), utilizing Sanger sequencing. We are joined by the developers of this method, Kai Blin and Tue Jorgensen, both affiliated with the Technical University of Denmark. Resources: Preprint: medRxiv Protocol: Protocols.io Software: GitHub Repository Web App: SSI BioLib These links provide access to the preprint article, the detailed experimental protocol, the open-source software repository, and a web application for running COVID-19 spike classification. This method represents a significant advancement in the rapid identification and classification of potentially harmful variants. Key Points Low-Cost SARS-CoV-2 Variant Identification Developed a Sanger sequencing method costing only $5 per sample Capable of detecting variants at high CT values (up to CT35) Requires minimal technical expertise and infrastructure Technical Approach Uses existing PCR infrastructure with minimal additional resources Implements strict contamination control protocols Provides a web-based tool (BioLib) for easy variant classification Accessibility... Read more at https://happykhan.com/microbinfie/mb-56-sars-cov-2-and-sequencing-spike-with-sanger-sequencing-part-2 In this segment, we explore a novel method for identifying variants of concern (VOCs), utilizing Sanger sequencing. We are joined by the developers of this method, Kai Blin and Tue Jorgensen, both affiliated with the Technical University of Denmark. Resources: Preprint: medRxiv Protocol: Protocols.io Software: GitHub Repository Web App: SSI BioLib These links provide access to the preprint article, the detailed experimental protocol, the open-source software repository, and a web application for running COVID-19 spike classification. This method represents a significant advancement in the rapid identification and classification of potentially harmful variants. Key Points Low-Cost SARS-CoV-2 Variant Identification Developed a Sanger sequencing method costing only $5 per sample Capable of detecting variants at high CT values (up to CT35) Requires minimal technical expertise and infrastructure Technical Approach Uses existing PCR infrastructure with minimal additional resources Implements strict contamination control protocols Provides a web-based tool (BioLib) for easy variant classification Accessibility... Read more at https://happykhan.com/microbinfie/mb-56-sars-cov-2-and-sequencing-spike-with-sanger-sequencing-part-2 tag:soundcloud,2010:tracks/1019197834 https://soundcloud.com/microbinfie/55-sars-cov-2-and-sequencing-spike-with-sanger-sequencing-welcome-to-1996 Thu, 08 Apr 2021 04:00:01 GMT 00:29:03 Microbial Bioinformatics no Today we’re going through a new method for identi… The microbinfie podcast explores an innovative method for rapid COVID-19 variant identification using Sanger sequencing, developed at the Technical University of Denmark to quickly detect and report variants of concern. Resources Preprint: Link to preprint on medRxiv Protocol: Sanger sequencing of a part of the SARS-CoV-2 spike Software: GitHub repository for COVID spike classification software Web App: SSI BioLib COVID Spike Classification App Note: The method discussed is specific to the spike protein of SARS-CoV-2, and emphasizes the use of Sanger sequencing for variant identification. Key Points Rapid Variant Detection Method Developed a simplified Sanger sequencing approach for COVID-19 variant screening Uses existing RT-PCR infrastructure and ARTIC protocol primers Can process up to 200 samples per day with minimal additional resources Detection and Reporting Process Targets a 1,001-base region in the spike protein Results available within 50-60 hours from sample collection Immediate reporting to hospitals and contact tracing authorities Practical... Read more at https://happykhan.com/microbinfie/mb-55-sars-cov-2-and-sequencing-spike-with-sanger-sequencing-welcome-to-1995 The microbinfie podcast explores an innovative method for rapid COVID-19 variant identification using Sanger sequencing, developed at the Technical University of Denmark to quickly detect and report variants of concern. Resources Preprint: Link to preprint on medRxiv Protocol: Sanger sequencing of a part of the SARS-CoV-2 spike Software: GitHub repository for COVID spike classification software Web App: SSI BioLib COVID Spike Classification App Note: The method discussed is specific to the spike protein of SARS-CoV-2, and emphasizes the use of Sanger sequencing for variant identification. Key Points Rapid Variant Detection Method Developed a simplified Sanger sequencing approach for COVID-19 variant screening Uses existing RT-PCR infrastructure and ARTIC protocol primers Can process up to 200 samples per day with minimal additional resources Detection and Reporting Process Targets a 1,001-base region in the spike protein Results available within 50-60 hours from sample collection Immediate reporting to hospitals and contact tracing authorities Practical... Read more at https://happykhan.com/microbinfie/mb-55-sars-cov-2-and-sequencing-spike-with-sanger-sequencing-welcome-to-1995 tag:soundcloud,2010:tracks/1016078002 https://soundcloud.com/microbinfie/54-harmonising-sars-cov-2-surveillance-in-canada-with-cancogen Thu, 01 Apr 2021 01:00:00 GMT 00:26:02 Microbial Bioinformatics no The Canadians have taken over the podcast - AGAIN… The microbinfie podcast explores the challenges of genomic data sharing and metadata harmonization during the SARS-CoV-2 pandemic in Canada, highlighting the complex interplay between privacy, public health, and national surveillance efforts. Join guest host Dr. Emma Griffiths as she talks with Dr. Finn McGuire and Dr. William Hsiao about the SARS-CoV-2 genomics epidemiology efforts in Canada. For more information, visit the CanCOGeN website. Extra notes The podcast discusses the challenges and frameworks for harmonizing metadata in microbial bioinformatics, particularly in the context of the National Genomic Surveillance Database and the CanCoGen initiative. The metadata management plan for CanCoGen consists of three tiers: 1. Low-risk, de-identified metadata that can be released publicly. 2. Middle-tier metadata useful for national surveillance and tracking, shared within national and provincial labs. 3. Local metadata, maintained by partners and potentially identifiable, which can be used for research after de-identification. Synchronizing metadata involves challenges due to differing... Read more at https://happykhan.com/microbinfie/mb-54-sars-cov-2-in-canada-and-addressing-data-sharing-and-privacy The microbinfie podcast explores the challenges of genomic data sharing and metadata harmonization during the SARS-CoV-2 pandemic in Canada, highlighting the complex interplay between privacy, public health, and national surveillance efforts. Join guest host Dr. Emma Griffiths as she talks with Dr. Finn McGuire and Dr. William Hsiao about the SARS-CoV-2 genomics epidemiology efforts in Canada. For more information, visit the CanCOGeN website. Extra notes The podcast discusses the challenges and frameworks for harmonizing metadata in microbial bioinformatics, particularly in the context of the National Genomic Surveillance Database and the CanCoGen initiative. The metadata management plan for CanCoGen consists of three tiers: 1. Low-risk, de-identified metadata that can be released publicly. 2. Middle-tier metadata useful for national surveillance and tracking, shared within national and provincial labs. 3. Local metadata, maintained by partners and potentially identifiable, which can be used for research after de-identification. Synchronizing metadata involves challenges due to differing... Read more at https://happykhan.com/microbinfie/mb-54-sars-cov-2-in-canada-and-addressing-data-sharing-and-privacy tag:soundcloud,2010:tracks/1016044426 https://soundcloud.com/microbinfie/sars-cov-2-surveillance-in-canada-with-cancogen Thu, 25 Mar 2021 13:07:16 GMT 00:33:06 Microbial Bioinformatics no The Canadians have taken over the podcast ! Joi… The microbinfie podcast explores SARS-CoV-2 genomic surveillance in Canada, highlighting the complex, decentralized approach to pandemic research and data sharing across multiple provinces and institutions. Join guest host Dr. Emma Griffiths as she engages in an insightful conversation with Dr. Finlay McGuire and Dr. William Hsiao about the SARS-CoV-2 genomics epidemiology efforts in Canada. Discover how the scientific community is uncovering valuable insights to fight COVID-19 through cutting-edge research and collaboration. Explore more about these efforts by visiting the Cancogen website. Key Points Canadian COVID-19 Genomic Surveillance Highly variable pandemic impact across provinces, with case counts ranging dramatically Genomic sequencing coverage differs widely, from 1.9% to 46% in different regions Collaborative national network (Cancogen) coordinates sequencing efforts Decentralized Health System Challenges Provincial health authorities control data collection and sharing National Microbiology Lab serves as central coordination point Data sharing agreements are ongoing and complex Genomic Research Infrastructure Multiple institutions involved:... Read more at https://happykhan.com/microbinfie/mb-53-sars-cov-2-surveillance-in-canada-with-cancogen The microbinfie podcast explores SARS-CoV-2 genomic surveillance in Canada, highlighting the complex, decentralized approach to pandemic research and data sharing across multiple provinces and institutions. Join guest host Dr. Emma Griffiths as she engages in an insightful conversation with Dr. Finlay McGuire and Dr. William Hsiao about the SARS-CoV-2 genomics epidemiology efforts in Canada. Discover how the scientific community is uncovering valuable insights to fight COVID-19 through cutting-edge research and collaboration. Explore more about these efforts by visiting the Cancogen website. Key Points Canadian COVID-19 Genomic Surveillance Highly variable pandemic impact across provinces, with case counts ranging dramatically Genomic sequencing coverage differs widely, from 1.9% to 46% in different regions Collaborative national network (Cancogen) coordinates sequencing efforts Decentralized Health System Challenges Provincial health authorities control data collection and sharing National Microbiology Lab serves as central coordination point Data sharing agreements are ongoing and complex Genomic Research Infrastructure Multiple institutions involved:... Read more at https://happykhan.com/microbinfie/mb-53-sars-cov-2-surveillance-in-canada-with-cancogen tag:soundcloud,2010:tracks/1006634275 https://soundcloud.com/microbinfie/sars-cov-2-sequencing-in-denmark-with-mads-albertsen Thu, 18 Mar 2021 05:00:13 GMT 00:28:35 Microbial Bioinformatics no Denmark is one of the leading countries in the wo… Prof. Mads Albertsen from Aalborg University shares insights into Denmark's rapid COVID-19 genomic sequencing efforts during the early pandemic, highlighting the national infrastructure and technological adaptations for viral genome tracking. Denmark is one of the leading countries in the world for SARS-CoV-2 genomic surveillance. Prof. Mads Albertsen discusses with us the intricacies of SARS-CoV-2 sequencing in Denmark, covering its inception, logistics, adjusted protocols, and key lessons learned throughout the process. Edited by Niamh Page Key Points Pandemic Response and Sequencing Infrastructure Rapidly pivoted existing research projects to COVID-19 sequencing Established genomic surveillance within weeks of pandemic onset Utilized Nanopore MinION sequencing with optimized protocols National Testing and Sequencing Workflow Automated sample processing through national laboratories Developed efficient sequencing pipeline with 5-10 day turnaround Implemented robust protocols for large-scale viral genome tracking Future of Genomic Surveillance Demonstrated potential for widespread genomic sequencing Identified need for expert interpretation of genomic data Potential... Read more at https://happykhan.com/microbinfie/mb-52-sars-cov-2-sequencing-in-denmark-with-mads-albertsen Prof. Mads Albertsen from Aalborg University shares insights into Denmark's rapid COVID-19 genomic sequencing efforts during the early pandemic, highlighting the national infrastructure and technological adaptations for viral genome tracking. Denmark is one of the leading countries in the world for SARS-CoV-2 genomic surveillance. Prof. Mads Albertsen discusses with us the intricacies of SARS-CoV-2 sequencing in Denmark, covering its inception, logistics, adjusted protocols, and key lessons learned throughout the process. Edited by Niamh Page Key Points Pandemic Response and Sequencing Infrastructure Rapidly pivoted existing research projects to COVID-19 sequencing Established genomic surveillance within weeks of pandemic onset Utilized Nanopore MinION sequencing with optimized protocols National Testing and Sequencing Workflow Automated sample processing through national laboratories Developed efficient sequencing pipeline with 5-10 day turnaround Implemented robust protocols for large-scale viral genome tracking Future of Genomic Surveillance Demonstrated potential for widespread genomic sequencing Identified need for expert interpretation of genomic data Potential... Read more at https://happykhan.com/microbinfie/mb-52-sars-cov-2-sequencing-in-denmark-with-mads-albertsen tag:soundcloud,2010:tracks/1004378554 https://soundcloud.com/microbinfie/51-sarscov2-round-up-3-and-updates-from-denmark Thu, 11 Mar 2021 03:00:18 GMT 00:33:39 Microbial Bioinformatics no We discuss the latest developments in SARS-CoV-2 … The microbinfie podcast explores the latest developments in SARS-CoV-2 genomics, focusing on variant tracking, genomic surveillance, and emerging research tools during the COVID-19 pandemic in March 2021. In the past two weeks, there have been significant developments in SARS-CoV-2 genomics, as discussed with Mads Albertsen, particularly in Denmark. For the latest COVID statistics in Denmark, visit their statistics page. Guests Mads Albertsen - Twitter Tools and Resources Outbreak Info: A resource for gathering data about outbreaks. Outbreak Info: SARS-CoV-2 Mutation Situation Reports: Detailed reports on the mutation landscape. GitLab Repository by Johan Bernal Morales: Tools related to SARS-CoV-2 research. Publications A Comparison of Performance for Different SARS-CoV-2 Sequencing Protocols examines the efficiency of various sequencing protocols. Before the Surge: Molecular Evidence of SARS-CoV-2 in New York City Prior to the First Report provides insight into the early presence of the virus in NYC. SARS-CoV-2 Within-host Diversity and Transmission: An article... Read more at https://happykhan.com/microbinfie/mb-51-sarscov2-round-up-3-and-updates-from-denmark The microbinfie podcast explores the latest developments in SARS-CoV-2 genomics, focusing on variant tracking, genomic surveillance, and emerging research tools during the COVID-19 pandemic in March 2021. In the past two weeks, there have been significant developments in SARS-CoV-2 genomics, as discussed with Mads Albertsen, particularly in Denmark. For the latest COVID statistics in Denmark, visit their statistics page. Guests Mads Albertsen - Twitter Tools and Resources Outbreak Info: A resource for gathering data about outbreaks. Outbreak Info: SARS-CoV-2 Mutation Situation Reports: Detailed reports on the mutation landscape. GitLab Repository by Johan Bernal Morales: Tools related to SARS-CoV-2 research. Publications A Comparison of Performance for Different SARS-CoV-2 Sequencing Protocols examines the efficiency of various sequencing protocols. Before the Surge: Molecular Evidence of SARS-CoV-2 in New York City Prior to the First Report provides insight into the early presence of the virus in NYC. SARS-CoV-2 Within-host Diversity and Transmission: An article... Read more at https://happykhan.com/microbinfie/mb-51-sarscov2-round-up-3-and-updates-from-denmark tag:soundcloud,2010:tracks/911314330 https://soundcloud.com/microbinfie/50-atypical-invasive-non-typhoidal-salmonella-in-the-gambia Thu, 25 Feb 2021 04:00:08 GMT 00:40:46 Microbial Bioinformatics no Invasive non-typhoidal Salmonella is a significan… The microbinfie podcast explores invasive non-typhoidal Salmonella (iNTS) research in The Gambia, highlighting genomic approaches to understanding pathogen diversity and public health challenges in sub-Saharan Africa. Invasive non-typhoidal Salmonella (iNTS) presents a significant public health challenge in Africa. To gain insights into this pressing issue, we spoke with Abdoulie Kanteh and Grant Mackenzie about their research efforts in The Gambia, particularly their use of genomics to understand the serovars in circulation. Guests Abdoulie Kanteh Grant Mackenzie Genomic Insights The work of Kanteh and Mackenzie involves advanced genomic techniques to study the diversity and spread of different Salmonella serovars in The Gambia. By employing genomics, they can map out the strains that are prevalent, identify potential outbreaks, and improve public health responses to this invasive pathogen. For more detailed findings on their research, refer to their manuscript published on bioRxiv: Access the Manuscript Their innovative approach plays a crucial role in... Read more at https://happykhan.com/microbinfie/mb-50-atypical-invasive-non-typhoidal-salmonella-in-the-gambia The microbinfie podcast explores invasive non-typhoidal Salmonella (iNTS) research in The Gambia, highlighting genomic approaches to understanding pathogen diversity and public health challenges in sub-Saharan Africa. Invasive non-typhoidal Salmonella (iNTS) presents a significant public health challenge in Africa. To gain insights into this pressing issue, we spoke with Abdoulie Kanteh and Grant Mackenzie about their research efforts in The Gambia, particularly their use of genomics to understand the serovars in circulation. Guests Abdoulie Kanteh Grant Mackenzie Genomic Insights The work of Kanteh and Mackenzie involves advanced genomic techniques to study the diversity and spread of different Salmonella serovars in The Gambia. By employing genomics, they can map out the strains that are prevalent, identify potential outbreaks, and improve public health responses to this invasive pathogen. For more detailed findings on their research, refer to their manuscript published on bioRxiv: Access the Manuscript Their innovative approach plays a crucial role in... Read more at https://happykhan.com/microbinfie/mb-50-atypical-invasive-non-typhoidal-salmonella-in-the-gambia tag:soundcloud,2010:tracks/989496307 https://soundcloud.com/microbinfie/49-sars-cov-2-tools-and-resources-update Mon, 22 Feb 2021 04:00:05 GMT 00:32:52 Microbial Bioinformatics no We are joined by Peter van Heusden to discuss all… The microbinfie podcast explores the rapidly evolving landscape of SARS-CoV-2 genomics, featuring insights from Peter van Heusden about emerging tools, resources, and data-sharing challenges in COVID-19 genomic research. We are excited to have Peter van Heusden join us to discuss the latest developments in SARS-CoV-2 genomics, focusing particularly on the tools and resources available. Additionally, we will delve into the challenges of building and sharing data in large-scale sequencing endeavors. Guests Peter van Heusden - Twitter Tools and Resources Nextalign Latest releases can be found on GitHub. COG Mutation Explorer Access the mutation explorer here. Grinch Explore more about it at COV Lineages. New US Tool for Variants Information is available on the CDC Variants Page and the CDC Global Variant Map. Online Lineage Assignment Utilize this tool at Pangolin. CoronaHiT Paper Published The publication is accessible on Genome Medicine. ] Key Points SARS-CoV-2 Genomic Analysis Tools NextAlign provides ultra-fast... Read more at https://happykhan.com/microbinfie/mb-49-sars-cov-2-tools-and-resources-update The microbinfie podcast explores the rapidly evolving landscape of SARS-CoV-2 genomics, featuring insights from Peter van Heusden about emerging tools, resources, and data-sharing challenges in COVID-19 genomic research. We are excited to have Peter van Heusden join us to discuss the latest developments in SARS-CoV-2 genomics, focusing particularly on the tools and resources available. Additionally, we will delve into the challenges of building and sharing data in large-scale sequencing endeavors. Guests Peter van Heusden - Twitter Tools and Resources Nextalign Latest releases can be found on GitHub. COG Mutation Explorer Access the mutation explorer here. Grinch Explore more about it at COV Lineages. New US Tool for Variants Information is available on the CDC Variants Page and the CDC Global Variant Map. Online Lineage Assignment Utilize this tool at Pangolin. CoronaHiT Paper Published The publication is accessible on Genome Medicine. ] Key Points SARS-CoV-2 Genomic Analysis Tools NextAlign provides ultra-fast... Read more at https://happykhan.com/microbinfie/mb-49-sars-cov-2-tools-and-resources-update tag:soundcloud,2010:tracks/989422207 https://soundcloud.com/microbinfie/48-sars-cov-2-more-variants-of-concern-and-updates-from-africa Sat, 20 Feb 2021 13:26:50 GMT 00:28:58 Microbial Bioinformatics no We discuss the latest developments in SARS-CoV-2 … In episode 48 of the microbinfie podcast, the hosts discuss the rapidly evolving landscape of SARS-CoV-2 genomics, focusing on emerging variants and their implications for public health, with a special emphasis on developments in Africa. In our discussion with Peter van Heusden, we explore the latest developments in SARS-CoV-2 genomics over the past two weeks. This includes an examination of the growing list of Variants of Concern and recent advancements in African regions. Below are some key papers and resources that were mentioned during our discussion: Guests Peter van Heusden - Twitter American Birds Study (MedRxiv Article) PANGO Lineages (Github Repository) PHE Thresholds for Different Variants (Government UK Publication) A.23.1 Variant in Uganda (MedRxiv Article) B.1.525 Variant (Github Issue) Zambia Sequences (CDC Report) Key Points SARS-CoV-2 Variants of Concern Multiple new variants emerging, including B.1.525 (Nigeria), A.23.1 (Uganda), and C.2 (Zimbabwe) E484K spike mutation found in multiple lineages, raising concerns... Read more at https://happykhan.com/microbinfie/mb-48-sars-cov-2-more-variants-of-concern-and-updates-from-africa In episode 48 of the microbinfie podcast, the hosts discuss the rapidly evolving landscape of SARS-CoV-2 genomics, focusing on emerging variants and their implications for public health, with a special emphasis on developments in Africa. In our discussion with Peter van Heusden, we explore the latest developments in SARS-CoV-2 genomics over the past two weeks. This includes an examination of the growing list of Variants of Concern and recent advancements in African regions. Below are some key papers and resources that were mentioned during our discussion: Guests Peter van Heusden - Twitter American Birds Study (MedRxiv Article) PANGO Lineages (Github Repository) PHE Thresholds for Different Variants (Government UK Publication) A.23.1 Variant in Uganda (MedRxiv Article) B.1.525 Variant (Github Issue) Zambia Sequences (CDC Report) Key Points SARS-CoV-2 Variants of Concern Multiple new variants emerging, including B.1.525 (Nigeria), A.23.1 (Uganda), and C.2 (Zimbabwe) E484K spike mutation found in multiple lineages, raising concerns... Read more at https://happykhan.com/microbinfie/mb-48-sars-cov-2-more-variants-of-concern-and-updates-from-africa tag:soundcloud,2010:tracks/981609127 https://soundcloud.com/microbinfie/47-sars-cov-2-rapid-roundup-and-questions-answered Mon, 08 Feb 2021 20:03:51 GMT 00:32:53 Microbial Bioinformatics no We present a rapid round up of SARS-CoV-2 questio… In this episode of the microbinfie podcast, experts discuss the intricate challenges of SARS-CoV-2 genomic analysis, exploring lineage classification, mutation tracking, and the complexities of viral genome sequencing. In this roundup, we delve into the latest questions and developments in SARS-CoV-2 genomics. This information is based on discussions and data recorded on 5 February 2021. Topics Covered SNP and Lineage Assignment: Explore how the absence of even a single Single Nucleotide Polymorphism (SNP) can disrupt the assignment of a viral lineage, and understand the mechanism behind it. Lineage Descriptions: How are viral lineages defined with sequences of mutation events? Convergent Evolution: Is convergent evolution occurring in SARS-CoV-2? Discover the trends being observed. Co-Infections: Have different SARS-CoV-2 lineages been found co-infecting individuals? Nanopore Basecalling: Should you use High Accuracy (HAC) basecalling, and is acquiring a GPU for this purpose beneficial? Sequencing Logistics: Address the basic logistical challenges of sequencing in various... Read more at https://happykhan.com/microbinfie/mb-47-sars-cov-2-rapid-roundup-and-questions-answered In this episode of the microbinfie podcast, experts discuss the intricate challenges of SARS-CoV-2 genomic analysis, exploring lineage classification, mutation tracking, and the complexities of viral genome sequencing. In this roundup, we delve into the latest questions and developments in SARS-CoV-2 genomics. This information is based on discussions and data recorded on 5 February 2021. Topics Covered SNP and Lineage Assignment: Explore how the absence of even a single Single Nucleotide Polymorphism (SNP) can disrupt the assignment of a viral lineage, and understand the mechanism behind it. Lineage Descriptions: How are viral lineages defined with sequences of mutation events? Convergent Evolution: Is convergent evolution occurring in SARS-CoV-2? Discover the trends being observed. Co-Infections: Have different SARS-CoV-2 lineages been found co-infecting individuals? Nanopore Basecalling: Should you use High Accuracy (HAC) basecalling, and is acquiring a GPU for this purpose beneficial? Sequencing Logistics: Address the basic logistical challenges of sequencing in various... Read more at https://happykhan.com/microbinfie/mb-47-sars-cov-2-rapid-roundup-and-questions-answered tag:soundcloud,2010:tracks/981548209 https://soundcloud.com/microbinfie/46-sars-cov-2-genomics-resources Mon, 08 Feb 2021 18:20:27 GMT 00:23:51 Microbial Bioinformatics no We discuss recent updates to the best SARS-CoV-2 … The microbinfie podcast explores the rapidly evolving landscape of SARS-CoV-2 genomics, highlighting cutting-edge resources and tracking methodologies for understanding viral variants during the COVID-19 pandemic. Stay up-to-date with the latest bioinformatics and genomics tools for SARS-CoV-2 research. Below are some valuable resources and tools to help you navigate ongoing developments in the field, as of 5 February 2021. Key Resources CoVariants Website: Explore different variants of SARS-CoV-2 through this dedicated platform. Visit CoVariants.org. Microreact: Visualize and share genomic data easily with the interactive Microreact platform. Check out the COG Consortium project at Microreact. Lineage Reports: Stay informed with the latest updates on SARS-CoV-2 lineages by visiting cov-lineages.org. CLIMB ARTIC Workshop: Access online resources from the CLIMB ARTIC and Big Data Joint Workshop at CLIMB. Multiplex PCR for Variants B.1.1.7, B.1.351, and P.1: Find protocols for Multiplexed RT-qPCR to detect these SARS-CoV-2 variants on Protocols.io. CDC Videos: Gain insights through educational... Read more at https://happykhan.com/microbinfie/mb-46-sars-cov-2-genomics-resources The microbinfie podcast explores the rapidly evolving landscape of SARS-CoV-2 genomics, highlighting cutting-edge resources and tracking methodologies for understanding viral variants during the COVID-19 pandemic. Stay up-to-date with the latest bioinformatics and genomics tools for SARS-CoV-2 research. Below are some valuable resources and tools to help you navigate ongoing developments in the field, as of 5 February 2021. Key Resources CoVariants Website: Explore different variants of SARS-CoV-2 through this dedicated platform. Visit CoVariants.org. Microreact: Visualize and share genomic data easily with the interactive Microreact platform. Check out the COG Consortium project at Microreact. Lineage Reports: Stay informed with the latest updates on SARS-CoV-2 lineages by visiting cov-lineages.org. CLIMB ARTIC Workshop: Access online resources from the CLIMB ARTIC and Big Data Joint Workshop at CLIMB. Multiplex PCR for Variants B.1.1.7, B.1.351, and P.1: Find protocols for Multiplexed RT-qPCR to detect these SARS-CoV-2 variants on Protocols.io. CDC Videos: Gain insights through educational... Read more at https://happykhan.com/microbinfie/mb-46-sars-cov-2-genomics-resources tag:soundcloud,2010:tracks/911118157 https://soundcloud.com/microbinfie/software-deep-dive-enterobase Thu, 04 Feb 2021 04:00:08 GMT 00:20:48 Microbial Bioinformatics no We chat with Nabil about EnteroBase, and learn ab… The microbinfie podcast explores the development of EnteroBase, an innovative bioinformatics platform for integrating bacterial genomic data and population structure analysis across multiple genera. We had a chat with Nabil about EnteroBase, delving into the background of the project, the general benefits of the platform, and some of the peculiar quirks users might encounter. EnteroBase is an integrated software environment designed to support the identification of global population structures within several bacterial genera, including pathogens. Key Papers PLOS Genetics Paper: Alikhan et al. (2018) "A Genomic Overview of the Population Structure of Salmonella." PLoS Genet 14 (4): e1007261. Read the paper Paper Describing EnteroBase: Zhou et al. (2020) "The EnteroBase User's Guide, with Case Studies on Salmonella Transmissions, Yersinia pestis Phylogeny, and Escherichia Core Genomic Diversity." Genome Res. 30:138-152. Read the paper rMLST Description: Jolley et al. (2012) Microbiology 158:1005-15. Read the paper Resources EnteroBase Website PubMLST Website EnteroBase Tutorials... Read more at https://happykhan.com/microbinfie/mb-45-software-deep-dive-enterobase The microbinfie podcast explores the development of EnteroBase, an innovative bioinformatics platform for integrating bacterial genomic data and population structure analysis across multiple genera. We had a chat with Nabil about EnteroBase, delving into the background of the project, the general benefits of the platform, and some of the peculiar quirks users might encounter. EnteroBase is an integrated software environment designed to support the identification of global population structures within several bacterial genera, including pathogens. Key Papers PLOS Genetics Paper: Alikhan et al. (2018) "A Genomic Overview of the Population Structure of Salmonella." PLoS Genet 14 (4): e1007261. Read the paper Paper Describing EnteroBase: Zhou et al. (2020) "The EnteroBase User's Guide, with Case Studies on Salmonella Transmissions, Yersinia pestis Phylogeny, and Escherichia Core Genomic Diversity." Genome Res. 30:138-152. Read the paper rMLST Description: Jolley et al. (2012) Microbiology 158:1005-15. Read the paper Resources EnteroBase Website PubMLST Website EnteroBase Tutorials... Read more at https://happykhan.com/microbinfie/mb-45-software-deep-dive-enterobase tag:soundcloud,2010:tracks/968531137 https://soundcloud.com/microbinfie/44-how-to-sequence-sars-cov-2-using-the-artic-protocol Fri, 22 Jan 2021 02:59:59 GMT 00:22:07 Microbial Bioinformatics no Joshua Quick from the University of Birmingham ta… In this episode of the microbinfie podcast, Joshua Quick from the University of Birmingham provides an in-depth exploration of SARS-CoV-2 sequencing using the ARTIC protocol, highlighting the critical techniques and challenges in viral genome analysis during the COVID-19 pandemic. Joshua Quick from the University of Birmingham presented on the topic "How to Sequence SARS-CoV-2 Using the ARTIC Protocol" during a workshop. This event was a collaborative effort between the ARTIC Network and CLIMB-BIG-DATA focused on COVID-19 data analysis. The session was chaired by Nick Loman. Useful Links Twitter Announcement Primal Scheme Tool nCOV-2019 Sequencing Protocol V3 (LoCost) on Protocols.io ARTIC Network GitHub (RAMPART) Key Concepts SARS-CoV-2: The virus responsible for COVID-19. ARTIC Protocol: A widely used protocol for sequencing SARS-CoV-2. Sequencing: A method used to determine the genetic sequence of an organism. COVID-19 Data Analysis: Involves analyzing viral genetic sequences to track mutation and transmission. The workshop aimed at equipping... Read more at https://happykhan.com/microbinfie/mb-44-how-to-sequence-sars-cov-2-using-the-artic-protocol-with-joshua-quick In this episode of the microbinfie podcast, Joshua Quick from the University of Birmingham provides an in-depth exploration of SARS-CoV-2 sequencing using the ARTIC protocol, highlighting the critical techniques and challenges in viral genome analysis during the COVID-19 pandemic. Joshua Quick from the University of Birmingham presented on the topic "How to Sequence SARS-CoV-2 Using the ARTIC Protocol" during a workshop. This event was a collaborative effort between the ARTIC Network and CLIMB-BIG-DATA focused on COVID-19 data analysis. The session was chaired by Nick Loman. Useful Links Twitter Announcement Primal Scheme Tool nCOV-2019 Sequencing Protocol V3 (LoCost) on Protocols.io ARTIC Network GitHub (RAMPART) Key Concepts SARS-CoV-2: The virus responsible for COVID-19. ARTIC Protocol: A widely used protocol for sequencing SARS-CoV-2. Sequencing: A method used to determine the genetic sequence of an organism. COVID-19 Data Analysis: Involves analyzing viral genetic sequences to track mutation and transmission. The workshop aimed at equipping... Read more at https://happykhan.com/microbinfie/mb-44-how-to-sequence-sars-cov-2-using-the-artic-protocol-with-joshua-quick tag:soundcloud,2010:tracks/968061943 https://soundcloud.com/microbinfie/43-why-use-genomics-in-an-epidemic Thu, 21 Jan 2021 02:59:59 GMT 00:18:39 Microbial Bioinformatics no Sam Sheppard from the University of Bath presents… In this episode of the microbinfie podcast, Sam Sheppard explores the evolution of molecular epidemiology, highlighting how genomic technologies have transformed our understanding of pathogen strain identification and outbreak tracking. Presenter: Sam Sheppard, University of Bath Event: ARTICnetwork & CLIMB-BIG-DATA Workshop on COVID-19 Data Analysis Key Points Use of Genomics in Epidemics: Sam Sheppard discussed the importance of integrating genomics in the study and management of epidemics, focusing on its application in understanding COVID-19. Background on Typing Schemes: He provided an overview of different typing schemes that can be used for bacterial and viral pathogens and their relevance in tracking the spread of diseases. Sequencing Methods: The presentation covered various sequencing techniques, highlighting their benefits and constraints, and how these can be applied to study pathogens at a genomic level. Challenges in Genomic Data Analysis: Sheppard addressed the issues faced while analyzing large volumes of genomic data. This includes data... Read more at https://happykhan.com/microbinfie/mb-43-why-use-genomics-in-an-epidemic-with-sam-sheppard In this episode of the microbinfie podcast, Sam Sheppard explores the evolution of molecular epidemiology, highlighting how genomic technologies have transformed our understanding of pathogen strain identification and outbreak tracking. Presenter: Sam Sheppard, University of Bath Event: ARTICnetwork & CLIMB-BIG-DATA Workshop on COVID-19 Data Analysis Key Points Use of Genomics in Epidemics: Sam Sheppard discussed the importance of integrating genomics in the study and management of epidemics, focusing on its application in understanding COVID-19. Background on Typing Schemes: He provided an overview of different typing schemes that can be used for bacterial and viral pathogens and their relevance in tracking the spread of diseases. Sequencing Methods: The presentation covered various sequencing techniques, highlighting their benefits and constraints, and how these can be applied to study pathogens at a genomic level. Challenges in Genomic Data Analysis: Sheppard addressed the issues faced while analyzing large volumes of genomic data. This includes data... Read more at https://happykhan.com/microbinfie/mb-43-why-use-genomics-in-an-epidemic-with-sam-sheppard tag:soundcloud,2010:tracks/968019349 https://soundcloud.com/microbinfie/42-overcoming-barriers-to-sars-cov-2-data-analysis Wed, 20 Jan 2021 02:59:59 GMT 00:46:30 Microbial Bioinformatics no ARTICnetwork & CLIMB-BIG-DATA present a panel dis… In this episode of the microbinfie podcast, panelists from the ARTIC Network and CLIMB-BIG-DATA workshop discuss COVID-19 genomics challenges, data analysis strategies, and collaborative bioinformatics efforts during the pandemic. Presented by: ARTIC Network & CLIMB-BIG-DATA Panelists: Nick Loman and Will Rowe - University of Birmingham Áine O'Toole - University of Edinburgh Andrew Page - Quadram Institute Anna Price - MRC CLIMB and Cardiff University This panel discussion was part of a comprehensive workshop focused on COVID-19 data analysis. Below is a summary of the topics covered and the resources shared during the event. Topics Covered Collecting Sample Metadata Intrapatient Variability Building Bridges with Policy Makers to Initiate Sequencing Data Sharing Improving Bioinformatics Skills Pipeline and Software Validation Bioinformatics Reproducibility and Quality Papers The PHA4GE SARS-CoV-2 Contextual Data Specification for Open Genomic Epidemiology Read the preprint here MAJORA: Continuous Integration Supporting Decentralized Sequencing for SARS-CoV-2 Genomic Surveillance Read the preprint here... Read more at https://happykhan.com/microbinfie/mb-42-overcoming-barriers-to-sars-cov-2-data-analysis In this episode of the microbinfie podcast, panelists from the ARTIC Network and CLIMB-BIG-DATA workshop discuss COVID-19 genomics challenges, data analysis strategies, and collaborative bioinformatics efforts during the pandemic. Presented by: ARTIC Network & CLIMB-BIG-DATA Panelists: Nick Loman and Will Rowe - University of Birmingham Áine O'Toole - University of Edinburgh Andrew Page - Quadram Institute Anna Price - MRC CLIMB and Cardiff University This panel discussion was part of a comprehensive workshop focused on COVID-19 data analysis. Below is a summary of the topics covered and the resources shared during the event. Topics Covered Collecting Sample Metadata Intrapatient Variability Building Bridges with Policy Makers to Initiate Sequencing Data Sharing Improving Bioinformatics Skills Pipeline and Software Validation Bioinformatics Reproducibility and Quality Papers The PHA4GE SARS-CoV-2 Contextual Data Specification for Open Genomic Epidemiology Read the preprint here MAJORA: Continuous Integration Supporting Decentralized Sequencing for SARS-CoV-2 Genomic Surveillance Read the preprint here... Read more at https://happykhan.com/microbinfie/mb-42-overcoming-barriers-to-sars-cov-2-data-analysis tag:soundcloud,2010:tracks/967805281 https://soundcloud.com/microbinfie/41-sars-cov-2-phylogenomics-questions-answered Tue, 19 Jan 2021 02:59:59 GMT 00:25:17 Microbial Bioinformatics no ARTICnetwork & CLIMB-BIG-DATA present a panel dis… This panel served as an informative session shedding light on the nuances of SARS-CoV-2 phylogenomics, including methodological insights and tools for genome analysis. Presented by: ARTICnetwork & CLIMB-BIG-DATA Panelists: Nick Loman - University of Birmingham Verity Hill - University of Edinburgh Andrew Page - Quadram Institute Anna Price - MRC CLIMB and Cardiff University This discussion was part of a broader workshop focused on COVID-19 data analysis. Topics Covered: More about Polecat: Understanding its utility in the analysis of SARS-CoV-2. COG-UK Phylotypes vs. Pangolin Lineages: Exploring the differences between these classifications. Civet and Llama: Differentiating these tools and their use case scenarios. Using BLAST for SARS-CoV-2: Can it identify similar genomes? Finding Similar Sequences: Techniques for placing sample sequences in context using public repositories. Manual Curation for PangoLEARN: Understanding the process and its importance. Subtree Selection in Civet: Criteria and methods used in defining subtrees. Adaptation of Civet for Other... Read more at https://happykhan.com/microbinfie/mb-41-sars-cov-2-phylogenomics-questions-answered This panel served as an informative session shedding light on the nuances of SARS-CoV-2 phylogenomics, including methodological insights and tools for genome analysis. Presented by: ARTICnetwork & CLIMB-BIG-DATA Panelists: Nick Loman - University of Birmingham Verity Hill - University of Edinburgh Andrew Page - Quadram Institute Anna Price - MRC CLIMB and Cardiff University This discussion was part of a broader workshop focused on COVID-19 data analysis. Topics Covered: More about Polecat: Understanding its utility in the analysis of SARS-CoV-2. COG-UK Phylotypes vs. Pangolin Lineages: Exploring the differences between these classifications. Civet and Llama: Differentiating these tools and their use case scenarios. Using BLAST for SARS-CoV-2: Can it identify similar genomes? Finding Similar Sequences: Techniques for placing sample sequences in context using public repositories. Manual Curation for PangoLEARN: Understanding the process and its importance. Subtree Selection in Civet: Criteria and methods used in defining subtrees. Adaptation of Civet for Other... Read more at https://happykhan.com/microbinfie/mb-41-sars-cov-2-phylogenomics-questions-answered tag:soundcloud,2010:tracks/966757894 https://soundcloud.com/microbinfie/40-a-crash-course-in-sars-cov-2-bioinformatics Mon, 18 Jan 2021 06:00:19 GMT 00:57:26 Microbial Bioinformatics no Over the last year we've learnt a lot about SARS-… The microbinfie podcast explores the complexities and challenges of SARS-CoV-2 bioinformatics, drawing from the hosts' extensive experience in sequencing and analyzing viral genomes during the COVID-19 pandemic. Over the last year, we've learned a lot about the genomics of SARS-CoV-2. Lee extracts all the insider knowledge from our brains, and we give him the honest truth to his probing questions. Here’s what we cover: Pipelines for SARS-CoV-2 Archives & Metadata Read Filtering Assembly vs. Consensus Amplicon Data Analysis Controls If Things Look Too Good Coverage Useful Resources Here are some helpful URLs for further exploration: ncov2019-artic-nf on GitHub ncov-tools on GitHub SARS-CoV-2-trueTree on GitHub (/microbinfie-transcripts/episode-40.txt) Key Points Bioinformatics Challenges Transitioning from bacterial to viral genome analysis requires specialized approaches Amplicon sequencing introduces unique technical complexities Every single nucleotide variant (SNP) is critical in SARS-CoV-2 analysis Data Processing Pitfalls Careful handling of synthetic primer sequences is essential Human read contamination must... Read more at https://happykhan.com/microbinfie/mb-40-a-crash-course-in-sars-cov-2-bioinformatics The microbinfie podcast explores the complexities and challenges of SARS-CoV-2 bioinformatics, drawing from the hosts' extensive experience in sequencing and analyzing viral genomes during the COVID-19 pandemic. Over the last year, we've learned a lot about the genomics of SARS-CoV-2. Lee extracts all the insider knowledge from our brains, and we give him the honest truth to his probing questions. Here’s what we cover: Pipelines for SARS-CoV-2 Archives & Metadata Read Filtering Assembly vs. Consensus Amplicon Data Analysis Controls If Things Look Too Good Coverage Useful Resources Here are some helpful URLs for further exploration: ncov2019-artic-nf on GitHub ncov-tools on GitHub SARS-CoV-2-trueTree on GitHub (/microbinfie-transcripts/episode-40.txt) Key Points Bioinformatics Challenges Transitioning from bacterial to viral genome analysis requires specialized approaches Amplicon sequencing introduces unique technical complexities Every single nucleotide variant (SNP) is critical in SARS-CoV-2 analysis Data Processing Pitfalls Careful handling of synthetic primer sequences is essential Human read contamination must... Read more at https://happykhan.com/microbinfie/mb-40-a-crash-course-in-sars-cov-2-bioinformatics tag:soundcloud,2010:tracks/966778999 https://soundcloud.com/microbinfie/explaining-the-naming-of-sars-cov-2-new-variants Sat, 16 Jan 2021 14:26:41 GMT 00:20:24 Microbial Bioinformatics no Andrew talks to Niamh Tumelty from the University… In this episode of the microbinfie podcast, Andrew and guest Niamh Tumelty from the University of Cambridge dive deep into the complex world of SARS-CoV-2 variant naming and classification, exploring the challenges of tracking viral genomic changes during a global pandemic. Andrew's discussion with Niamh Tumelty from the University of Cambridge revolves around the various names and classifications emerging for the new variants of SARS-CoV-2. As this is a rapidly evolving field, the information you hear might be outdated by the time you listen. Andrew humorously apologizes in advance for any errors that might exist in the podcast. For those interested in more detailed information, Andrew suggests an article on Nature that provides further insights: Link to the article. The conversation aims to clear up some confusion surrounding the numerous names and classifications, helping listeners better understand the ongoing developments in the pandemic. Extra notes Genomic Analysis and Variation: -... Read more at https://happykhan.com/microbinfie/mb-39-explaining-the-naming-of-sars-cov-2-new-variants In this episode of the microbinfie podcast, Andrew and guest Niamh Tumelty from the University of Cambridge dive deep into the complex world of SARS-CoV-2 variant naming and classification, exploring the challenges of tracking viral genomic changes during a global pandemic. Andrew's discussion with Niamh Tumelty from the University of Cambridge revolves around the various names and classifications emerging for the new variants of SARS-CoV-2. As this is a rapidly evolving field, the information you hear might be outdated by the time you listen. Andrew humorously apologizes in advance for any errors that might exist in the podcast. For those interested in more detailed information, Andrew suggests an article on Nature that provides further insights: Link to the article. The conversation aims to clear up some confusion surrounding the numerous names and classifications, helping listeners better understand the ongoing developments in the pandemic. Extra notes Genomic Analysis and Variation: -... Read more at https://happykhan.com/microbinfie/mb-39-explaining-the-naming-of-sars-cov-2-new-variants tag:soundcloud,2010:tracks/910380709 https://soundcloud.com/microbinfie/38-ontology-2 Thu, 07 Jan 2021 15:09:59 GMT 00:31:43 Microbial Bioinformatics no Dr Emma Griffiths and Dr João Carriço join us for… In this episode of the microbinfie podcast, hosts explore the critical role of ontologies in standardizing and sharing scientific data across disciplines, featuring insights from experts Dr. Emma Griffiths and Dr. João Carriço. Join us for the second part of our crash course on ontologies, featuring insights from Dr. Emma Griffiths and Dr. João Carriço. In this session, the focus will be on effective data sharing techniques and strategies. Dr. Griffiths and Dr. Carriço are experts in the field and will guide us through the intricacies of utilizing ontologies to facilitate better data sharing practices. Whether you're involved in bioinformatics, computer science, or any field where data plays a crucial role, this session is essential for understanding how to leverage ontologies for maximum impact. Guests Dr. Emma Griffiths and Dr. João Carriço Key Topics: Basics of ontologies and their importance in data sharing Strategies for integrating ontologies into existing data... Read more at https://happykhan.com/microbinfie/mb-38-ontologies-effective-data-sharing In this episode of the microbinfie podcast, hosts explore the critical role of ontologies in standardizing and sharing scientific data across disciplines, featuring insights from experts Dr. Emma Griffiths and Dr. João Carriço. Join us for the second part of our crash course on ontologies, featuring insights from Dr. Emma Griffiths and Dr. João Carriço. In this session, the focus will be on effective data sharing techniques and strategies. Dr. Griffiths and Dr. Carriço are experts in the field and will guide us through the intricacies of utilizing ontologies to facilitate better data sharing practices. Whether you're involved in bioinformatics, computer science, or any field where data plays a crucial role, this session is essential for understanding how to leverage ontologies for maximum impact. Guests Dr. Emma Griffiths and Dr. João Carriço Key Topics: Basics of ontologies and their importance in data sharing Strategies for integrating ontologies into existing data... Read more at https://happykhan.com/microbinfie/mb-38-ontologies-effective-data-sharing tag:soundcloud,2010:tracks/910324912 https://soundcloud.com/microbinfie/ontology Thu, 24 Dec 2020 04:00:18 GMT 00:24:46 Microbial Bioinformatics no Dr Emma Griffiths and Dr João Carriço join us to … The microbinfie podcast explores the critical role of ontologies in bioinformatics, revealing how standardized vocabularies bridge communication gaps across scientific disciplines and enable more effective data interpretation and sharing. Join Dr. Emma Griffiths and Dr. João Carriço for an insightful discussion about the vital role of ontologies in bioinformatics. This "secret sauce" ensures effective communication and collaboration across diverse disciplines such as public health, food regulation, agriculture, veterinary sciences, and healthcare. Microbial genomics data often resembles the Tower of Babel, with each field using its own language to describe similar concepts. So, how do we bridge these gaps and achieve successful interdisciplinary work? Tune in to discover why you need ontologies in your life and how they can facilitate better understanding and cooperation across various sectors. Guests Dr. Emma Griffiths and Dr. João Carriço Extra notes Ontology in Bioinformatics: - Ontologies are described as controlled vocabularies organized into hierarchies with... Read more at https://happykhan.com/microbinfie/mb-37-ontologies-the-secret-sauce-of-bioinformatics The microbinfie podcast explores the critical role of ontologies in bioinformatics, revealing how standardized vocabularies bridge communication gaps across scientific disciplines and enable more effective data interpretation and sharing. Join Dr. Emma Griffiths and Dr. João Carriço for an insightful discussion about the vital role of ontologies in bioinformatics. This "secret sauce" ensures effective communication and collaboration across diverse disciplines such as public health, food regulation, agriculture, veterinary sciences, and healthcare. Microbial genomics data often resembles the Tower of Babel, with each field using its own language to describe similar concepts. So, how do we bridge these gaps and achieve successful interdisciplinary work? Tune in to discover why you need ontologies in your life and how they can facilitate better understanding and cooperation across various sectors. Guests Dr. Emma Griffiths and Dr. João Carriço Extra notes Ontology in Bioinformatics: - Ontologies are described as controlled vocabularies organized into hierarchies with... Read more at https://happykhan.com/microbinfie/mb-37-ontologies-the-secret-sauce-of-bioinformatics tag:soundcloud,2010:tracks/899876332 https://soundcloud.com/microbinfie/roary-the-pangenome-pipeline Thu, 10 Dec 2020 05:00:30 GMT 00:21:35 Microbial Bioinformatics no We chat with Andrew about Roary, software for gen… In this microbinfie podcast episode, Andrew Page discusses Roary, a powerful pangenome pipeline designed to solve computational challenges in bacterial genomic analysis. The software addresses scalability issues in generating comprehensive bacterial genome representations. We chat with Andrew about Roary, software for generating a pangenome, and learn about the background to the project, where the name comes from, hidden features and the light hearted FAQ. Paper: academic.oup.com/bioinformatics/a…1/22/3691/240757 Software: github.com/sanger-pathogens/Roary Documentation: sanger-pathogens.github.io/Roary/ Extra notes The primary focus of the discussion was on solving the challenges of creating and analyzing bacterial pan genomes, especially at scale. A pan genome involves collecting all genomic content within a species, which includes both core and accessory genes. This is crucial for understanding genetic variations that affect survivability in different environments. The software Roary was developed to generate pan genomes efficiently, designed originally to serve the needs within the Sanger Institute where existing tools were inadequate for... Read more at https://happykhan.com/microbinfie/mb-36-roary-the-pangenome-pipeline In this microbinfie podcast episode, Andrew Page discusses Roary, a powerful pangenome pipeline designed to solve computational challenges in bacterial genomic analysis. The software addresses scalability issues in generating comprehensive bacterial genome representations. We chat with Andrew about Roary, software for generating a pangenome, and learn about the background to the project, where the name comes from, hidden features and the light hearted FAQ. Paper: academic.oup.com/bioinformatics/a…1/22/3691/240757 Software: github.com/sanger-pathogens/Roary Documentation: sanger-pathogens.github.io/Roary/ Extra notes The primary focus of the discussion was on solving the challenges of creating and analyzing bacterial pan genomes, especially at scale. A pan genome involves collecting all genomic content within a species, which includes both core and accessory genes. This is crucial for understanding genetic variations that affect survivability in different environments. The software Roary was developed to generate pan genomes efficiently, designed originally to serve the needs within the Sanger Institute where existing tools were inadequate for... Read more at https://happykhan.com/microbinfie/mb-36-roary-the-pangenome-pipeline tag:soundcloud,2010:tracks/908307031 https://soundcloud.com/microbinfie/35-the-wandering-bioinformatician Thu, 26 Nov 2020 04:00:02 GMT 00:26:22 Microbial Bioinformatics no Have you ever wanted to pack in your job and move… In this episode of the microbinfie podcast, Phil Ashton shares his fascinating journey as a bioinformatician working in low and middle-income countries, discussing his experiences in Vietnam and Malawi. We recently had the opportunity to chat with Phil Ashton about his fascinating career transition from the wet lab to the dry lab, taking on the role of a bioinformatician. Below, Phil shares his experiences working in public health and in low and middle-income countries. Guests Phil Ashton, a bioinformatician at the Malawi Liverpool Welcome Unit, shares his transition from a wet lab to bioinformatics. Phil's Career Journey Move to Vietnam: - Phil and his wife relocated shortly after their wedding in September 2016. - The decision was somewhat spontaneous, motivated by a job offer found on Twitter regarding fungal genomes. - Worked on Cryptococcus meningitis, affecting individuals with HIV. Family Life in Vietnam: - Their son, Joshua, was born in... Read more at https://happykhan.com/microbinfie/mb-35-the-wandering-bioinformatician In this episode of the microbinfie podcast, Phil Ashton shares his fascinating journey as a bioinformatician working in low and middle-income countries, discussing his experiences in Vietnam and Malawi. We recently had the opportunity to chat with Phil Ashton about his fascinating career transition from the wet lab to the dry lab, taking on the role of a bioinformatician. Below, Phil shares his experiences working in public health and in low and middle-income countries. Guests Phil Ashton, a bioinformatician at the Malawi Liverpool Welcome Unit, shares his transition from a wet lab to bioinformatics. Phil's Career Journey Move to Vietnam: - Phil and his wife relocated shortly after their wedding in September 2016. - The decision was somewhat spontaneous, motivated by a job offer found on Twitter regarding fungal genomes. - Worked on Cryptococcus meningitis, affecting individuals with HIV. Family Life in Vietnam: - Their son, Joshua, was born in... Read more at https://happykhan.com/microbinfie/mb-35-the-wandering-bioinformatician tag:soundcloud,2010:tracks/907334761 https://soundcloud.com/microbinfie/34-moving-from-wet-to-dry-with-phil-ashton Thu, 12 Nov 2020 04:00:08 GMT 00:27:34 Microbial Bioinformatics no We chat with Phil Ashton about his move from the … In this episode of the microbinfie podcast, Phil Ashton shares his journey from wet lab researcher to bioinformatician, exploring the evolving landscape of computational biology in public health settings. We recently had the opportunity to chat with Phil Ashton about his fascinating career transition from the wet lab to the dry lab, taking on the role of a bioinformatician. Below, Phil shares his experiences working in public health and in low and middle-income countries. Guests Phil Ashton, a bioinformatician at the Malawi Liverpool Welcome Unit, shares his transition from a wet lab to bioinformatics. Transition to Bioinformatics Phil's journey from the wet lab, where hands-on experiments are conducted, to the dry lab, where computational analysis takes place, marks a significant shift in his scientific approach. Having a strong foundation in laboratory research provided Phil with a deep understanding of the fundamental mechanisms behind biological data, an essential asset for his... Read more at https://happykhan.com/microbinfie/mb-34-moving-from-wet-to-dry-with-phil-ashton In this episode of the microbinfie podcast, Phil Ashton shares his journey from wet lab researcher to bioinformatician, exploring the evolving landscape of computational biology in public health settings. We recently had the opportunity to chat with Phil Ashton about his fascinating career transition from the wet lab to the dry lab, taking on the role of a bioinformatician. Below, Phil shares his experiences working in public health and in low and middle-income countries. Guests Phil Ashton, a bioinformatician at the Malawi Liverpool Welcome Unit, shares his transition from a wet lab to bioinformatics. Transition to Bioinformatics Phil's journey from the wet lab, where hands-on experiments are conducted, to the dry lab, where computational analysis takes place, marks a significant shift in his scientific approach. Having a strong foundation in laboratory research provided Phil with a deep understanding of the fundamental mechanisms behind biological data, an essential asset for his... Read more at https://happykhan.com/microbinfie/mb-34-moving-from-wet-to-dry-with-phil-ashton tag:soundcloud,2010:tracks/911214574 https://soundcloud.com/microbinfie/33-bioinformatics-training Thu, 29 Oct 2020 04:00:24 GMT 00:33:30 Microbial Bioinformatics no Someone shows up at your door wanting to get a na… The microbinfie podcast explores the challenges of rapidly training individuals in bioinformatics, highlighting the complexities of teaching computational skills across diverse learner backgrounds and expertise levels. Someone shows up at your door wanting to get a nature paper in bioinformatics and they only have a week, where do you start? We talk bioinformatics training with Finlay Maguire. Guests Finlay Maguire Some notes Here are the key points from the episode: Training Expectations: - The discussion begins with the unrealistic expectation that one can learn bioinformatics and produce a high-impact research publication (like a Nature paper) in a short timeframe (e.g., four and a half days). - It emphasizes the importance of foundational knowledge in bioinformatics, biology, and programming. Challenges in Teaching: - Teaching mixed-ability groups can be difficult, with advanced learners getting bored and beginners overwhelmed. - Essential mental models that many learners lack include understanding file systems and functions.... Read more at https://happykhan.com/microbinfie/mb-33-the-untrained-monkey The microbinfie podcast explores the challenges of rapidly training individuals in bioinformatics, highlighting the complexities of teaching computational skills across diverse learner backgrounds and expertise levels. Someone shows up at your door wanting to get a nature paper in bioinformatics and they only have a week, where do you start? We talk bioinformatics training with Finlay Maguire. Guests Finlay Maguire Some notes Here are the key points from the episode: Training Expectations: - The discussion begins with the unrealistic expectation that one can learn bioinformatics and produce a high-impact research publication (like a Nature paper) in a short timeframe (e.g., four and a half days). - It emphasizes the importance of foundational knowledge in bioinformatics, biology, and programming. Challenges in Teaching: - Teaching mixed-ability groups can be difficult, with advanced learners getting bored and beginners overwhelmed. - Essential mental models that many learners lack include understanding file systems and functions.... Read more at https://happykhan.com/microbinfie/mb-33-the-untrained-monkey tag:soundcloud,2010:tracks/909854656 https://soundcloud.com/microbinfie/majora Thu, 15 Oct 2020 03:00:14 GMT 00:39:16 Microbial Bioinformatics no Nick Loman, Sam Nicholls and Radosław Popławski j… The microbinfie podcast explores the development of Majora, a critical database infrastructure created during the COVID-19 pandemic to support rapid SARS-CoV-2 genome sequencing across the United Kingdom. Join Nick Loman, Sam Nicholls, and Radosław Popławski as they discuss the development of systems to support the analysis of hundreds of thousands of SARS-CoV-2 genomes during the pandemic, notably without the use of Excel. Learn more about MAJORA, a system for continuous integration supporting decentralized sequencing for SARS-CoV-2 genomic surveillance. You can access the preprint here. For more information, visit the COG-UK Consortium website. Here are the main points from the episode: Majora Database: - Majora is the central database infrastructure supporting COG-UK's sequencing efforts. - It connects distributed sequencing hubs, integrating sequence data and sample metadata for analysis and public database uploads. Motivation for Majora: - The need for an agile and flexible software solution arose from the sudden demand for... Read more at https://happykhan.com/microbinfie/mb-32-looking-behind-majora-s-mask-and-nation-wide-tracking-of-sars-cov-2-genomics The microbinfie podcast explores the development of Majora, a critical database infrastructure created during the COVID-19 pandemic to support rapid SARS-CoV-2 genome sequencing across the United Kingdom. Join Nick Loman, Sam Nicholls, and Radosław Popławski as they discuss the development of systems to support the analysis of hundreds of thousands of SARS-CoV-2 genomes during the pandemic, notably without the use of Excel. Learn more about MAJORA, a system for continuous integration supporting decentralized sequencing for SARS-CoV-2 genomic surveillance. You can access the preprint here. For more information, visit the COG-UK Consortium website. Here are the main points from the episode: Majora Database: - Majora is the central database infrastructure supporting COG-UK's sequencing efforts. - It connects distributed sequencing hubs, integrating sequence data and sample metadata for analysis and public database uploads. Motivation for Majora: - The need for an agile and flexible software solution arose from the sudden demand for... Read more at https://happykhan.com/microbinfie/mb-32-looking-behind-majora-s-mask-and-nation-wide-tracking-of-sars-cov-2-genomics tag:soundcloud,2010:tracks/901142494 https://soundcloud.com/microbinfie/31-large-scale-sequencing-of-sars-cov-2-genomes-from-one-region Thu, 01 Oct 2020 04:01:14 GMT 00:53:02 Microbial Bioinformatics no We chat to Justin O'Grady, Andrew Page and Alison… The microbinfie podcast explores large-scale SARS-CoV-2 genome sequencing efforts in Norfolk, UK, highlighting the critical role of genomic epidemiology during the COVID-19 pandemic. In a recent discussion, we spoke with Justin O'Grady, Andrew Page, and Alison Mather about their work on sequencing 1,500 SARS-CoV-2 genomes from Norfolk, a small region in the UK. Their efforts contributed significantly to genomic epidemiology, providing a near real-time view of the COVID-19 pandemic as it unfolded. Here are some key insights from their findings: Genomic Diversity: Researchers identified 100 distinct UK lineages in the Norfolk area. Lineage Distribution Among Key Workers: Sixteen UK lineages were found in key workers but were not observed in patients or within community care settings. Sequencing Intensity: They sequenced 172 genomes from SARS-CoV-2 positive samples per 100,000 population, representing 42.6% of all positive cases. High-Quality Data: A total of 1,035 SARS-CoV-2 genomes were sequenced to a high standard of... Read more at https://happykhan.com/microbinfie/mb-31-large-scale-sequencing-of-sars-cov-2-genomes-from-one-region The microbinfie podcast explores large-scale SARS-CoV-2 genome sequencing efforts in Norfolk, UK, highlighting the critical role of genomic epidemiology during the COVID-19 pandemic. In a recent discussion, we spoke with Justin O'Grady, Andrew Page, and Alison Mather about their work on sequencing 1,500 SARS-CoV-2 genomes from Norfolk, a small region in the UK. Their efforts contributed significantly to genomic epidemiology, providing a near real-time view of the COVID-19 pandemic as it unfolded. Here are some key insights from their findings: Genomic Diversity: Researchers identified 100 distinct UK lineages in the Norfolk area. Lineage Distribution Among Key Workers: Sixteen UK lineages were found in key workers but were not observed in patients or within community care settings. Sequencing Intensity: They sequenced 172 genomes from SARS-CoV-2 positive samples per 100,000 population, representing 42.6% of all positive cases. High-Quality Data: A total of 1,035 SARS-CoV-2 genomes were sequenced to a high standard of... Read more at https://happykhan.com/microbinfie/mb-31-large-scale-sequencing-of-sars-cov-2-genomes-from-one-region tag:soundcloud,2010:tracks/882429553 https://soundcloud.com/microbinfie/30-how-we-made-the-podcast Thu, 17 Sep 2020 00:00:00 GMT 00:37:25 Microbial Bioinformatics no To help us celebrate a full year of the podcast a… In this milestone episode, the hosts of the microbinfie podcast reflect on their podcast's first year, exploring its origins, motivations, and collaborative journey through bioinformatics and microbial research. To celebrate a full year of our podcast, after our first episode on September 19, 2019, we dive into how it all began. In this episode, we cover various aspects, including: How We Met: Discover the story of our initial meeting and how our shared interests brought us together. Why We Started the Podcast: We explore the driving forces behind our decision to start a podcast. How We Actually Started It: Learn about the practical steps and challenges we faced in launching our first episode. Tune in to gain insight into our journey and celebrate this milestone with us! In this milestone episode, the hosts of the microbinfie podcast reflect on their podcast's first year, exploring its origins, motivations, and collaborative journey through bioinformatics and microbial research. To celebrate a full year of our podcast, after our first episode on September 19, 2019, we dive into how it all began. In this episode, we cover various aspects, including: How We Met: Discover the story of our initial meeting and how our shared interests brought us together. Why We Started the Podcast: We explore the driving forces behind our decision to start a podcast. How We Actually Started It: Learn about the practical steps and challenges we faced in launching our first episode. Tune in to gain insight into our journey and celebrate this milestone with us! tag:soundcloud,2010:tracks/877321804 https://soundcloud.com/microbinfie/mashtree-software-deep-dive Thu, 10 Sep 2020 01:59:59 GMT 00:19:12 Microbial Bioinformatics no Paper: https://joss.theoj.org/papers/10.21105/jos… In this microbinfie podcast episode, Lee Katz discusses MASHtree, a rapid bioinformatics tool for comparing microbial genomes and generating approximate phylogenetic trees using MinHash algorithms. The podcast discusses the development and implementation of MASHtree, a tool leveraging the MASH and MinHash algorithms to rapidly compare microbial genomes and build phylogenetic trees. MASHtree uses the concept of k-mers to minimize the data size, transforming it into a smaller footprint (e.g., 15 MB raw data to an 8 KB sketch file), which significantly accelerates genomic comparisons. The core of the algorithm involves converting the k-mers into integers and retaining the first 1,000, creating a much smaller, manageable dataset ideal for rapid computation. MASH distances generated by the tool align comparably to Average Nucleotide Identity (ANI), providing a quality approximation of phylogenetic relationships without needing fully assembled genomes. MASHtree utilizes a neighbor-joining algorithm to assemble the tree, which provides an approximation rather than... Read more at https://happykhan.com/microbinfie/mb-29-mashtree-software-deep-dive In this microbinfie podcast episode, Lee Katz discusses MASHtree, a rapid bioinformatics tool for comparing microbial genomes and generating approximate phylogenetic trees using MinHash algorithms. The podcast discusses the development and implementation of MASHtree, a tool leveraging the MASH and MinHash algorithms to rapidly compare microbial genomes and build phylogenetic trees. MASHtree uses the concept of k-mers to minimize the data size, transforming it into a smaller footprint (e.g., 15 MB raw data to an 8 KB sketch file), which significantly accelerates genomic comparisons. The core of the algorithm involves converting the k-mers into integers and retaining the first 1,000, creating a much smaller, manageable dataset ideal for rapid computation. MASH distances generated by the tool align comparably to Average Nucleotide Identity (ANI), providing a quality approximation of phylogenetic relationships without needing fully assembled genomes. MASHtree utilizes a neighbor-joining algorithm to assemble the tree, which provides an approximation rather than... Read more at https://happykhan.com/microbinfie/mb-29-mashtree-software-deep-dive tag:soundcloud,2010:tracks/844305547 https://soundcloud.com/microbinfie/28-brig-the-blast-ring-image-generator Thu, 27 Aug 2020 04:00:07 GMT 00:22:17 Microbial Bioinformatics no We chat to Nabil-Fareed Alikhan about the bioinfo… In this episode of the microbinfie podcast, Nabil-Fareed Alikhan discusses BRIG (BLAST Ring Image Generator), a bioinformatics visualization tool that simplifies genomic sequence comparisons through intuitive circular plots. BRIG is designed to assist researchers in representing genomic sequence data in a visually intuitive format. It generates circular images that represent BLAST comparisons, helping researchers easily compare bacterial genomes. Software: BRIG SourceForge Paper: BRIG BMC Genomics Article For those interested in genome visualization and analysis, Nabil-Fareed Alikhan's work offers a valuable tool that combines functionality with user-friendly graphics to enhance bioinformatics research. Extra notes Software Tools and Data Inputs: The discussion revolves around BRIG, a graphical user tool designed for visualizing genomic data. It accepts input formats such as GenBank, FASTA, and MultiFASTA, and displays results in a circular comparison plot. Users designate one genome as the reference, with others being compared to it. This visualization allows for easy identification of... Read more at https://happykhan.com/microbinfie/mb-28-brig-the-blast-ring-image-generator In this episode of the microbinfie podcast, Nabil-Fareed Alikhan discusses BRIG (BLAST Ring Image Generator), a bioinformatics visualization tool that simplifies genomic sequence comparisons through intuitive circular plots. BRIG is designed to assist researchers in representing genomic sequence data in a visually intuitive format. It generates circular images that represent BLAST comparisons, helping researchers easily compare bacterial genomes. Software: BRIG SourceForge Paper: BRIG BMC Genomics Article For those interested in genome visualization and analysis, Nabil-Fareed Alikhan's work offers a valuable tool that combines functionality with user-friendly graphics to enhance bioinformatics research. Extra notes Software Tools and Data Inputs: The discussion revolves around BRIG, a graphical user tool designed for visualizing genomic data. It accepts input formats such as GenBank, FASTA, and MultiFASTA, and displays results in a circular comparison plot. Users designate one genome as the reference, with others being compared to it. This visualization allows for easy identification of... Read more at https://happykhan.com/microbinfie/mb-28-brig-the-blast-ring-image-generator tag:soundcloud,2010:tracks/844112809 https://soundcloud.com/microbinfie/27-deep-dive-into-snp-sites Thu, 13 Aug 2020 04:00:03 GMT 00:13:46 Microbial Bioinformatics no We chat to the author of SNP-sites, bioinformatic… We recently had a conversation with the author of SNP-sites, (it's Andrew!) a bioinformatics software designed for extracting Single Nucleotide Polymorphisms (SNPs) from a multi-FASTA alignment. While the software may seem straightforward, it involves intricate details that are often absent from the final published work. Software Repository: SNP-sites on GitHub Research Paper: "SNP-sites: rapid efficient extraction of SNPs from multi-FASTA alignments" Authors: Andrew J. Page, Ben Taylor, Aidan J. Delaney, Jorge Soares, Torsten Seemann, Jacqueline A. Keane, Simon R. Harris Published in Microbial Genomics, Volume 2 Issue 4, 2016 We recently had a conversation with the author of SNP-sites, (it's Andrew!) a bioinformatics software designed for extracting Single Nucleotide Polymorphisms (SNPs) from a multi-FASTA alignment. While the software may seem straightforward, it involves intricate details that are often absent from the final published work. Software Repository: SNP-sites on GitHub Research Paper: "SNP-sites: rapid efficient extraction of SNPs from multi-FASTA alignments" Authors: Andrew J. Page, Ben Taylor, Aidan J. Delaney, Jorge Soares, Torsten Seemann, Jacqueline A. Keane, Simon R. Harris Published in Microbial Genomics, Volume 2 Issue 4, 2016 tag:soundcloud,2010:tracks/870812257 https://soundcloud.com/microbinfie/26-sars-cov-2-metadata Thu, 13 Aug 2020 01:00:03 GMT 00:37:46 Microbial Bioinformatics no We talk to Dr Emma Griffiths (UBC), Dr Ruth Timme… The microbinfie podcast explores the Public Health Alliance for Genomic Epidemiology (PHA4GE) and its critical work in developing standardized approaches for SARS-CoV-2 genomic data sharing during the COVID-19 pandemic. In this conversation, we engage with Dr. Emma Griffiths (UBC), Dr. Ruth Timme (FDA), and Dr. Duncan MacCannell (CDC) concerning the PHA4GE SARS-CoV-2 contextual data specification, designed for open genomic epidemiology. Resources Paper: PHA4GE SARS-CoV-2 Contextual Data Specification Specification: GitHub Repository Protocols: Protocols.io Workspace About PHA4GE The Public Health Alliance for Genomic Epidemiology (PHA4GE) (visit their website) is a global coalition dedicated to: Establishing consensus standards Documenting and sharing best practices Improving the availability of critical bioinformatic tools and resources Advocating for greater openness, interoperability, accessibility, and reproducibility in public health microbial bioinformatics Significance of the Specification With the ongoing pandemic, PHA4GE has recognized an urgent need for a specifically tailored, open-source SARS-CoV-2 contextual data standard. The team has developed an... Read more at https://happykhan.com/microbinfie/mb-26-sars-cov-2-contextual-data-specification-for-open-genomic-epidemiology The microbinfie podcast explores the Public Health Alliance for Genomic Epidemiology (PHA4GE) and its critical work in developing standardized approaches for SARS-CoV-2 genomic data sharing during the COVID-19 pandemic. In this conversation, we engage with Dr. Emma Griffiths (UBC), Dr. Ruth Timme (FDA), and Dr. Duncan MacCannell (CDC) concerning the PHA4GE SARS-CoV-2 contextual data specification, designed for open genomic epidemiology. Resources Paper: PHA4GE SARS-CoV-2 Contextual Data Specification Specification: GitHub Repository Protocols: Protocols.io Workspace About PHA4GE The Public Health Alliance for Genomic Epidemiology (PHA4GE) (visit their website) is a global coalition dedicated to: Establishing consensus standards Documenting and sharing best practices Improving the availability of critical bioinformatic tools and resources Advocating for greater openness, interoperability, accessibility, and reproducibility in public health microbial bioinformatics Significance of the Specification With the ongoing pandemic, PHA4GE has recognized an urgent need for a specifically tailored, open-source SARS-CoV-2 contextual data standard. The team has developed an... Read more at https://happykhan.com/microbinfie/mb-26-sars-cov-2-contextual-data-specification-for-open-genomic-epidemiology tag:soundcloud,2010:tracks/829243711 https://soundcloud.com/microbinfie/25-sustainable-bioinformatics-software Thu, 30 Jul 2020 01:00:06 GMT 00:27:09 Microbial Bioinformatics no How do you make bioinformatics software sustainab… In this episode of the microbinfie podcast, the hosts dive deep into the critical aspects of creating sustainable bioinformatics software, exploring best practices for developing robust, long-lasting computational tools that can transition from academic research to practical applications. To transition bioinformatics software from the realm of academic research into practical applications in hospitals and doctors' offices, it is crucial to focus on sustainability. Here, we discuss essential practices to enhance the sustainability of bioinformatics software: Documentation Thorough documentation is vital for the usability and longevity of any software. It ensures that both developers and users can effectively understand and use the software. Key aspects include: User Guides: Clear instructions on how to install, use, and troubleshoot the software. Developer Documentation: Detailed explanations of the code structure, algorithms, and data formats. FAQ and Support: Address common questions and issues users might encounter. Coding Styles Adopting consistent coding styles can prevent confusion... Read more at https://happykhan.com/microbinfie/mb-25-sustainable-bioinformatics-software In this episode of the microbinfie podcast, the hosts dive deep into the critical aspects of creating sustainable bioinformatics software, exploring best practices for developing robust, long-lasting computational tools that can transition from academic research to practical applications. To transition bioinformatics software from the realm of academic research into practical applications in hospitals and doctors' offices, it is crucial to focus on sustainability. Here, we discuss essential practices to enhance the sustainability of bioinformatics software: Documentation Thorough documentation is vital for the usability and longevity of any software. It ensures that both developers and users can effectively understand and use the software. Key aspects include: User Guides: Clear instructions on how to install, use, and troubleshoot the software. Developer Documentation: Detailed explanations of the code structure, algorithms, and data formats. FAQ and Support: Address common questions and issues users might encounter. Coding Styles Adopting consistent coding styles can prevent confusion... Read more at https://happykhan.com/microbinfie/mb-25-sustainable-bioinformatics-software tag:soundcloud,2010:tracks/829116589 https://soundcloud.com/microbinfie/24-experimental-projects-lead-to-experimental-software Thu, 16 Jul 2020 01:00:06 GMT 00:19:50 Microbial Bioinformatics no Experimental projects lead to experimental softwa… The microbinfie podcast explores the critical challenges of sustainability in bioinformatics software development, highlighting the systemic issues that lead to short-lived research tools and potential strategies for long-term maintenance. Experimental projects often result in the creation of experimental software. In the realm of academic research, especially within bioinformatics, this software plays a crucial role. However, there are several challenges concerning its sustainability. Here, we delve into the current functioning of bioinformatics software, the reasons behind software obsolescence, associated quality issues, and potential strategies to ensure its longevity. In academic bioinformatics, software is typically developed as a part of research projects. These tools are designed to address specific research questions and often remain experimental. They undergo rapid development cycles aligned with project timelines, which frequently means limited resources for long-term support and maintenance. Why Software Dies Several factors contribute to the premature "death" of bioinformatics software: Funding and Resources: Once a... Read more at https://happykhan.com/microbinfie/mb-24-experimental-projects-lead-to-experimental-software The microbinfie podcast explores the critical challenges of sustainability in bioinformatics software development, highlighting the systemic issues that lead to short-lived research tools and potential strategies for long-term maintenance. Experimental projects often result in the creation of experimental software. In the realm of academic research, especially within bioinformatics, this software plays a crucial role. However, there are several challenges concerning its sustainability. Here, we delve into the current functioning of bioinformatics software, the reasons behind software obsolescence, associated quality issues, and potential strategies to ensure its longevity. In academic bioinformatics, software is typically developed as a part of research projects. These tools are designed to address specific research questions and often remain experimental. They undergo rapid development cycles aligned with project timelines, which frequently means limited resources for long-term support and maintenance. Why Software Dies Several factors contribute to the premature "death" of bioinformatics software: Funding and Resources: Once a... Read more at https://happykhan.com/microbinfie/mb-24-experimental-projects-lead-to-experimental-software tag:soundcloud,2010:tracks/850174978 https://soundcloud.com/microbinfie/23-coronahit-nanopore Thu, 02 Jul 2020 02:00:11 GMT 00:28:48 Microbial Bioinformatics no We chat with the authors of CoronaHiT which lets … The microbinfie podcast explores CoronaHiT, an innovative method for multiplexing SARS-CoV-2 genome sequencing on Oxford Nanopore technology, dramatically reducing sequencing costs and increasing sample throughput. In this engaging discussion, we chat with the authors behind CoronaHiT, an innovative method that allows for sequencing up to 94 SARS-CoV-2 samples on a single MinION flowcell. This approach significantly reduces sequencing costs by three-fold and employs a simpler, faster protocol. Guests Justin O'Grady David Baker Topics Covered Here’s a summary of the key points discussing the CoronaHIT method for multiplexing SARS-CoV-2 sequencing on Oxford Nanopore technology: CoronaHIT Overview: - The method is designed to increase throughput and decrease costs by allowing the simultaneous processing of multiple samples. - The original method processed 24 samples per run at about £40 each, while CoronaHIT reduces this cost to between £13 and £18 per sample. Technical Innovations: - CoronaHIT uses a low input Nextera method to... Read more at https://happykhan.com/microbinfie/mb-23-coronahit-large-scale-multiplexing-of-sars-cov-2-genomes-on-nanopore The microbinfie podcast explores CoronaHiT, an innovative method for multiplexing SARS-CoV-2 genome sequencing on Oxford Nanopore technology, dramatically reducing sequencing costs and increasing sample throughput. In this engaging discussion, we chat with the authors behind CoronaHiT, an innovative method that allows for sequencing up to 94 SARS-CoV-2 samples on a single MinION flowcell. This approach significantly reduces sequencing costs by three-fold and employs a simpler, faster protocol. Guests Justin O'Grady David Baker Topics Covered Here’s a summary of the key points discussing the CoronaHIT method for multiplexing SARS-CoV-2 sequencing on Oxford Nanopore technology: CoronaHIT Overview: - The method is designed to increase throughput and decrease costs by allowing the simultaneous processing of multiple samples. - The original method processed 24 samples per run at about £40 each, while CoronaHIT reduces this cost to between £13 and £18 per sample. Technical Innovations: - CoronaHIT uses a low input Nextera method to... Read more at https://happykhan.com/microbinfie/mb-23-coronahit-large-scale-multiplexing-of-sars-cov-2-genomes-on-nanopore tag:soundcloud,2010:tracks/770093671 https://soundcloud.com/microbinfie/22-assembly-after-party Thu, 25 Jun 2020 01:00:02 GMT 00:32:06 Microbial Bioinformatics no When you get an assembly the fun doesnt stop ther… In this episode of the microbinfie podcast, the hosts dive deep into genome assembly post-processing, exploring techniques to improve and validate genomic sequence quality. The discussion covers critical steps from initial assembly to final quality assessment. When you get an assembly, the fun doesn’t stop there. You then have to fix it up and see how good it is. In this episode, we discuss scaffolding, gap filling, polishing, assembly metrics, quality control, genome structure, and visualization tools. Tools and Papers Mentioned: socru PLoS Neglected Tropical Diseases Article In this context, scaffolding refers to the process of connecting genomic sequences into larger, more complete units. Gap filling addresses missing segments in these sequences. Polishing improves assembly accuracy by correcting errors. Assembly metrics are used to evaluate the quality of the assembled genome. Quality control ensures that the genome assembly is accurate and reliable. Genome structure refers to the arrangement of genes... Read more at https://happykhan.com/microbinfie/mb-22-assembly-after-party In this episode of the microbinfie podcast, the hosts dive deep into genome assembly post-processing, exploring techniques to improve and validate genomic sequence quality. The discussion covers critical steps from initial assembly to final quality assessment. When you get an assembly, the fun doesn’t stop there. You then have to fix it up and see how good it is. In this episode, we discuss scaffolding, gap filling, polishing, assembly metrics, quality control, genome structure, and visualization tools. Tools and Papers Mentioned: socru PLoS Neglected Tropical Diseases Article In this context, scaffolding refers to the process of connecting genomic sequences into larger, more complete units. Gap filling addresses missing segments in these sequences. Polishing improves assembly accuracy by correcting errors. Assembly metrics are used to evaluate the quality of the assembled genome. Quality control ensures that the genome assembly is accurate and reliable. Genome structure refers to the arrangement of genes... Read more at https://happykhan.com/microbinfie/mb-22-assembly-after-party tag:soundcloud,2010:tracks/839000155 https://soundcloud.com/microbinfie/coronavirus-sequencing-qib Tue, 16 Jun 2020 06:00:04 GMT 00:28:58 Microbial Bioinformatics no We chat to Justin O'Grady and Andrew Page on how … In this microbinfie podcast episode, Dr. Justin O'Grady and Dr. Andrew Page discuss their rapid SARS-CoV-2 genome sequencing efforts during the COVID-19 pandemic, highlighting the UK's collaborative and agile scientific response. In this interview, we speak with Justin O'Grady and Andrew Page about how to initiate a SARS-CoV-2 sequencing effort during a pandemic. Their team went on to sequence 1,500 genomes in just two months. The Quadram Institute is one of 16 sequencing centers in the UK that are part of the COVID-19 genome sequencing consortium. Guests Justin O'Grady Key Topics COG-UK Consortium: The COVID-19 Genomics UK Consortium, referred to as COG, plays a crucial role in the sequencing efforts. Contamination Issues: Challenges faced during sequencing due to contamination and measures taken to mitigate these issues. People: Highlighting the teamwork and dedication of the individuals involved in the project. Bioinformatics: The role of bioinformatics in analyzing the massive amount of... Read more at https://happykhan.com/microbinfie/mb-21-setting-up-coronavirus-sequencing-for-real-time-public-health-surveillance In this microbinfie podcast episode, Dr. Justin O'Grady and Dr. Andrew Page discuss their rapid SARS-CoV-2 genome sequencing efforts during the COVID-19 pandemic, highlighting the UK's collaborative and agile scientific response. In this interview, we speak with Justin O'Grady and Andrew Page about how to initiate a SARS-CoV-2 sequencing effort during a pandemic. Their team went on to sequence 1,500 genomes in just two months. The Quadram Institute is one of 16 sequencing centers in the UK that are part of the COVID-19 genome sequencing consortium. Guests Justin O'Grady Key Topics COG-UK Consortium: The COVID-19 Genomics UK Consortium, referred to as COG, plays a crucial role in the sequencing efforts. Contamination Issues: Challenges faced during sequencing due to contamination and measures taken to mitigate these issues. People: Highlighting the teamwork and dedication of the individuals involved in the project. Bioinformatics: The role of bioinformatics in analyzing the massive amount of... Read more at https://happykhan.com/microbinfie/mb-21-setting-up-coronavirus-sequencing-for-real-time-public-health-surveillance tag:soundcloud,2010:tracks/770088196 https://soundcloud.com/microbinfie/20-assembly-read-healing Thu, 11 Jun 2020 07:00:08 GMT 00:17:07 Microbial Bioinformatics no Preprocessing of sequence data in advance of de n… In this episode of the microbinfie podcast, the hosts delve deep into read preprocessing techniques and challenges in genome assembly, exploring sophisticated methods to enhance sequencing data quality before assembly. Preprocessing sequence data before de novo assembly is a crucial step in enhancing the final quality of your assembly. This involves various techniques such as read trimming, correction, and filtering, which are collectively known as Read Healing. Key Steps in Read Healing Read Trimming: Removing low-quality bases from the ends of reads to improve overall sequence quality. Correction: Identifying and fixing sequencing errors that may have occurred during the sequencing process. Filtering: Discarding reads that do not meet specific quality criteria to ensure that only high-quality data is used in the assembly process. We also mentioned PlasmidTron, which can be found on GitHub under the Sanger Pathogens organization. Extra notes Key Points on Microbial Bioinformatics: Data Preprocessing and Quality Control:... Read more at https://happykhan.com/microbinfie/mb-20-assembly-read-healing In this episode of the microbinfie podcast, the hosts delve deep into read preprocessing techniques and challenges in genome assembly, exploring sophisticated methods to enhance sequencing data quality before assembly. Preprocessing sequence data before de novo assembly is a crucial step in enhancing the final quality of your assembly. This involves various techniques such as read trimming, correction, and filtering, which are collectively known as Read Healing. Key Steps in Read Healing Read Trimming: Removing low-quality bases from the ends of reads to improve overall sequence quality. Correction: Identifying and fixing sequencing errors that may have occurred during the sequencing process. Filtering: Discarding reads that do not meet specific quality criteria to ensure that only high-quality data is used in the assembly process. We also mentioned PlasmidTron, which can be found on GitHub under the Sanger Pathogens organization. Extra notes Key Points on Microbial Bioinformatics: Data Preprocessing and Quality Control:... Read more at https://happykhan.com/microbinfie/mb-20-assembly-read-healing tag:soundcloud,2010:tracks/767640103 https://soundcloud.com/microbinfie/microbinfies-assemble Thu, 28 May 2020 06:00:03 GMT 00:25:24 Microbial Bioinformatics no Short read de novo assembly is discussed in this … The microbinfie podcast explores the fascinating progression of genome assembly techniques, highlighting the computational challenges and innovations in reconstructing genomic sequences from fragmented DNA reads. In this episode, we dive into the fascinating topic of short read de novo assembly. We explore the history of assembly techniques and the evolution of short read assemblers, culminating in the advanced tools we utilize today. Our discussion mainly revolves around bacterial assembly and its implications in the field of genomics. You can expect to learn about: The origins and development of assembly methods. How short read technology has transformed assembler capabilities. Innovations and challenges specific to bacterial genome assembly. Here’s a summary of the key points discussed in the MicroBinfeed podcast episode on short read genome assembly: Genome Assembly Overview: - The problem of genome assembly arises from sequencing DNA in small fragments rather than as complete chromosomes. - De novo genome assembly... Read more at https://happykhan.com/microbinfie/mb-19-microbinfies-assemble The microbinfie podcast explores the fascinating progression of genome assembly techniques, highlighting the computational challenges and innovations in reconstructing genomic sequences from fragmented DNA reads. In this episode, we dive into the fascinating topic of short read de novo assembly. We explore the history of assembly techniques and the evolution of short read assemblers, culminating in the advanced tools we utilize today. Our discussion mainly revolves around bacterial assembly and its implications in the field of genomics. You can expect to learn about: The origins and development of assembly methods. How short read technology has transformed assembler capabilities. Innovations and challenges specific to bacterial genome assembly. Here’s a summary of the key points discussed in the MicroBinfeed podcast episode on short read genome assembly: Genome Assembly Overview: - The problem of genome assembly arises from sequencing DNA in small fragments rather than as complete chromosomes. - De novo genome assembly... Read more at https://happykhan.com/microbinfie/mb-19-microbinfies-assemble tag:soundcloud,2010:tracks/746428444 https://soundcloud.com/microbinfie/18-has-nanopore-rendered-onsite-illumina-obsolete Thu, 14 May 2020 00:00:03 GMT 00:19:09 Microbial Bioinformatics no A panel discussion held in MRC Gambia at The Lond… The microbinfie podcast explores the evolving landscape of sequencing technologies, focusing on the potential of nanopore sequencing to transform microbial genomics research, particularly in resource-limited settings. The panel discussion was held at the MRC Gambia about SARS-CoV-2, part of The London School of Hygiene and Tropical Medicine, in January 2020. This event was recorded in front of a live audience of scientists, just as SARS-CoV-2 was beginning to be reported as an emerging infectious disease. Panelists Andrew Page - Quadram Institute David Baker - Quadram Institute Ozan Gundogdu - London School of Hygiene and Tropical Medicine (UK) Abdul Sesay - London School of Hygiene and Tropical Medicine (Gambia) Nick Loman - University of Birmingham Chair: Suzie Hingley-Wilson, University of Surrey Participants Mark Pallen - Quadram Institute Muna Anjum - APHA Arnoud van Vliet - University of Surrey Martin Antonio - London School of Hygiene and Tropical Medicine Archie Worwui -... Read more at https://happykhan.com/microbinfie/mb-18-panel-has-nanopore-rendered-onsite-illumina-obsolete The microbinfie podcast explores the evolving landscape of sequencing technologies, focusing on the potential of nanopore sequencing to transform microbial genomics research, particularly in resource-limited settings. The panel discussion was held at the MRC Gambia about SARS-CoV-2, part of The London School of Hygiene and Tropical Medicine, in January 2020. This event was recorded in front of a live audience of scientists, just as SARS-CoV-2 was beginning to be reported as an emerging infectious disease. Panelists Andrew Page - Quadram Institute David Baker - Quadram Institute Ozan Gundogdu - London School of Hygiene and Tropical Medicine (UK) Abdul Sesay - London School of Hygiene and Tropical Medicine (Gambia) Nick Loman - University of Birmingham Chair: Suzie Hingley-Wilson, University of Surrey Participants Mark Pallen - Quadram Institute Muna Anjum - APHA Arnoud van Vliet - University of Surrey Martin Antonio - London School of Hygiene and Tropical Medicine Archie Worwui -... Read more at https://happykhan.com/microbinfie/mb-18-panel-has-nanopore-rendered-onsite-illumina-obsolete tag:soundcloud,2010:tracks/739228246 https://soundcloud.com/microbinfie/17-bayesian-magic-in-practice Thu, 30 Apr 2020 06:00:08 GMT 00:32:06 Microbial Bioinformatics no The second part of the dark world of Bayesian mag… The microbinfie podcast explores the practical applications of Bayesian methods in bioinformatics and phylogenetics, providing insights into computational techniques for understanding evolutionary relationships. Join Dr. Conor Meehan, Dr. Leo Martins, and Dr. Nabil-Fareed Alikhan as they delve deeper into the fascinating realm of Bayesian methodologies. This part of the series continues the exploration of the Bayesian approach in various fields, shedding light on its applications and intricacies. Guests * Dr. Conor Meehan * Dr. Leo Martins Some notes Bayesian Models: - Not a philosophy or religion, but a class of models based on conditional probabilities. - Integrate various data sources for phylogenetic analysis. Key Concept: - Bayes' Theorem: The probability of a model given the data equals the probability of the data given the model multiplied by the prior probability of the model. Priors and Posteriors: - Prior: Initial belief about parameters before observing data. - Posterior: Updated belief after... Read more at https://happykhan.com/microbinfie/mb-17-bayesian-magic-in-practice The microbinfie podcast explores the practical applications of Bayesian methods in bioinformatics and phylogenetics, providing insights into computational techniques for understanding evolutionary relationships. Join Dr. Conor Meehan, Dr. Leo Martins, and Dr. Nabil-Fareed Alikhan as they delve deeper into the fascinating realm of Bayesian methodologies. This part of the series continues the exploration of the Bayesian approach in various fields, shedding light on its applications and intricacies. Guests * Dr. Conor Meehan * Dr. Leo Martins Some notes Bayesian Models: - Not a philosophy or religion, but a class of models based on conditional probabilities. - Integrate various data sources for phylogenetic analysis. Key Concept: - Bayes' Theorem: The probability of a model given the data equals the probability of the data given the model multiplied by the prior probability of the model. Priors and Posteriors: - Prior: Initial belief about parameters before observing data. - Posterior: Updated belief after... Read more at https://happykhan.com/microbinfie/mb-17-bayesian-magic-in-practice tag:soundcloud,2010:tracks/739227472 https://soundcloud.com/microbinfie/16-bayesian-magic-dealing-with-theory Thu, 16 Apr 2020 07:15:45 GMT 00:47:40 Microbial Bioinformatics no The dark world of Bayesian magic with Dr Conor Me… In this episode of the microbinfie podcast, Drs. Conor Meehan and Leo Martins explore the intricacies of Bayesian inference in phylogenetics, demystifying a powerful statistical approach that goes beyond traditional maximum likelihood methods. Dive into the intriguing realm of Bayesian statistics with these distinguished experts. Uncover the secrets of this powerful statistical method and explore its applications in various fields. Imbued with an aura of mystery and logic, Bayesian magic is not just for mathematicians but for anyone who seeks to understand and predict the uncertainties of the world. Join the discussion and immerse yourself in the profound concepts that shape our understanding of data and probability. Guests * Dr. Conor Meehan * Dr. Leo Martins What is Bayesian Inference? Definition: Bayesian inference is a mathematical framework based on conditional probabilities, used for hypothesis testing. Comparison: It contrasts with maximum likelihood methods, focusing on integrating multiple data sources. Importance of... Read more at https://happykhan.com/microbinfie/mb-16-the-theory-behind-bayesian-magic In this episode of the microbinfie podcast, Drs. Conor Meehan and Leo Martins explore the intricacies of Bayesian inference in phylogenetics, demystifying a powerful statistical approach that goes beyond traditional maximum likelihood methods. Dive into the intriguing realm of Bayesian statistics with these distinguished experts. Uncover the secrets of this powerful statistical method and explore its applications in various fields. Imbued with an aura of mystery and logic, Bayesian magic is not just for mathematicians but for anyone who seeks to understand and predict the uncertainties of the world. Join the discussion and immerse yourself in the profound concepts that shape our understanding of data and probability. Guests * Dr. Conor Meehan * Dr. Leo Martins What is Bayesian Inference? Definition: Bayesian inference is a mathematical framework based on conditional probabilities, used for hypothesis testing. Comparison: It contrasts with maximum likelihood methods, focusing on integrating multiple data sources. Importance of... Read more at https://happykhan.com/microbinfie/mb-16-the-theory-behind-bayesian-magic tag:soundcloud,2010:tracks/727720000 https://soundcloud.com/microbinfie/15-bioinformatics-war-stories Thu, 02 Apr 2020 05:00:02 GMT 00:10:39 Microbial Bioinformatics no We share short war stories about bioinformatics f… In this episode of the microbinfie podcast, hosts share candid 'war stories' from bioinformatics research, revealing the complex and sometimes unpredictable challenges in genomic data analysis and laboratory work. We share short war stories about bioinformatics from the trenches of research. We share tales about a mystery massive Listeria outbreak, bubbles on flowcells, GAII woes, contaminated databases, the mass murderer, water pouring into a sequencing centre, changing protocols without validation, Excel issues and the ultimate complexity in science - Humans. Extra notes Contamination Challenges: - There was a significant outbreak linked to Listeria monocytogenes contamination due to contaminated laboratory culture media, highlighting the need for vigilance beyond raw data acquisition. - An episode involving contamination of Salmonella detections due to genomic similarities with Shigella emphasizes the complexities in distinguishing closely related bacterial species in bioinformatics analyses. Technological Artifacts: - Issues with early sequencing technologies such as consistent adapter sequences causing... Read more at https://happykhan.com/microbinfie/mb-15-bioinformatics-war-stories In this episode of the microbinfie podcast, hosts share candid 'war stories' from bioinformatics research, revealing the complex and sometimes unpredictable challenges in genomic data analysis and laboratory work. We share short war stories about bioinformatics from the trenches of research. We share tales about a mystery massive Listeria outbreak, bubbles on flowcells, GAII woes, contaminated databases, the mass murderer, water pouring into a sequencing centre, changing protocols without validation, Excel issues and the ultimate complexity in science - Humans. Extra notes Contamination Challenges: - There was a significant outbreak linked to Listeria monocytogenes contamination due to contaminated laboratory culture media, highlighting the need for vigilance beyond raw data acquisition. - An episode involving contamination of Salmonella detections due to genomic similarities with Shigella emphasizes the complexities in distinguishing closely related bacterial species in bioinformatics analyses. Technological Artifacts: - Issues with early sequencing technologies such as consistent adapter sequences causing... Read more at https://happykhan.com/microbinfie/mb-15-bioinformatics-war-stories tag:soundcloud,2010:tracks/719460367 https://soundcloud.com/microbinfie/14-la-resistance-lives-on-the-amr-deep-dive Thu, 19 Mar 2020 06:00:00 GMT 00:27:16 Microbial Bioinformatics no Kate Baker talks AMR In this episode of the microbinfie podcast, Dr. Kate Baker explores the complex world of antimicrobial resistance (AMR) through a genomic and epidemiological lens, focusing particularly on Shigella and the mechanisms of resistance. In this episode, Prof. Kate Baker, a renowned expert in antimicrobial resistance (AMR), delves into the complexities and challenges posed by the rise of drug-resistant microorganisms. Some of what was covered included: Understanding AMR - Antimicrobial resistance occurs when microbes, such as bacteria, viruses, fungi, and parasites, evolve to resist the drugs designed to kill them. - The phenomenon is exacerbated by the overuse and misuse of antibiotics in healthcare and agriculture. Impact of AMR - AMR poses a significant threat to global health, food security, and development. - Common infections become harder to treat, leading to prolonged illnesses, increased medical costs, and a higher risk of mortality. The Role of Research - Scientific research is crucial... Read more at https://happykhan.com/microbinfie/mb-14-la-resistance-lives-on-the-amr-deep-dive In this episode of the microbinfie podcast, Dr. Kate Baker explores the complex world of antimicrobial resistance (AMR) through a genomic and epidemiological lens, focusing particularly on Shigella and the mechanisms of resistance. In this episode, Prof. Kate Baker, a renowned expert in antimicrobial resistance (AMR), delves into the complexities and challenges posed by the rise of drug-resistant microorganisms. Some of what was covered included: Understanding AMR - Antimicrobial resistance occurs when microbes, such as bacteria, viruses, fungi, and parasites, evolve to resist the drugs designed to kill them. - The phenomenon is exacerbated by the overuse and misuse of antibiotics in healthcare and agriculture. Impact of AMR - AMR poses a significant threat to global health, food security, and development. - Common infections become harder to treat, leading to prolonged illnesses, increased medical costs, and a higher risk of mortality. The Role of Research - Scientific research is crucial... Read more at https://happykhan.com/microbinfie/mb-14-la-resistance-lives-on-the-amr-deep-dive tag:soundcloud,2010:tracks/719280634 https://soundcloud.com/microbinfie/13-questions-not-to-ask Thu, 05 Mar 2020 06:00:00 GMT 00:29:34 Microbial Bioinformatics no Someone asks a simple question like "What program… In this episode of the microbinfie podcast, the hosts dive deep into the programming languages used in bioinformatics, focusing on the perennial debate between Perl and Python while exploring the broader landscape of coding tools for scientific computing. When someone asks, "What programming language should I learn?", especially in the context of bioinformatics, it's important to understand that the answer depends on several factors, including the specific areas of bioinformatics you’re interested in, the scope of your projects, and your existing skill set. Below is a discussion of different programming languages commonly used in bioinformatics, each with its strengths and applications: Python Overview: Python is a versatile and beginner-friendly language. It has a clean syntax, which makes it an excellent choice for new programmers. Use in Bioinformatics: Widely used for scripting and small-scale bioinformatics tasks, such as data analysis and automation. Libraries like Biopython, NumPy, and Pandas extend its functionality... Read more at https://happykhan.com/microbinfie/mb-13-questions-not-to-ask In this episode of the microbinfie podcast, the hosts dive deep into the programming languages used in bioinformatics, focusing on the perennial debate between Perl and Python while exploring the broader landscape of coding tools for scientific computing. When someone asks, "What programming language should I learn?", especially in the context of bioinformatics, it's important to understand that the answer depends on several factors, including the specific areas of bioinformatics you’re interested in, the scope of your projects, and your existing skill set. Below is a discussion of different programming languages commonly used in bioinformatics, each with its strengths and applications: Python Overview: Python is a versatile and beginner-friendly language. It has a clean syntax, which makes it an excellent choice for new programmers. Use in Bioinformatics: Widely used for scripting and small-scale bioinformatics tasks, such as data analysis and automation. Libraries like Biopython, NumPy, and Pandas extend its functionality... Read more at https://happykhan.com/microbinfie/mb-13-questions-not-to-ask tag:soundcloud,2010:tracks/719460007 https://soundcloud.com/microbinfie/12-phylogenetics-with-the-arborists-part2 Thu, 20 Feb 2020 06:00:00 GMT 00:32:01 Microbial Bioinformatics no 12 Phylogenetics with the arborists part 2 by Mic… The microbinfie podcast delves into the complex world of phylogenetic modeling, exploring the nuanced approaches to constructing evolutionary trees and understanding genetic relationships across different biological systems. In this episode we talk about models of evolution help estimate transitions between states (e.g., nucleotide mutations) and fit the evolutionary patterns to build phylogenetic trees. Guests * Dr. Conor Meehan * Dr. Leo Martins Types of Models Broad Categories: Models can vary based on: - Transition probabilities (e.g., from one nucleotide to another). - Covariance among sites (heterogeneity across sites). - Specific models discussed include: - CAT Models: Different implementations for nucleotide or amino acid data. - Gamma-Distributed Models: Addressing rate variation across sites. - Best Model Selection: Determined by model testing rather than a one-size-fits-all approach. The best model depends on the dataset. Historical Context Model Evolution: Discussion on the evolution of phylogenetic models, such as DNAML and Fast DNAML, leading... Read more at https://happykhan.com/microbinfie/mb-12-phylogenetics-with-the-arborists-part-2 The microbinfie podcast delves into the complex world of phylogenetic modeling, exploring the nuanced approaches to constructing evolutionary trees and understanding genetic relationships across different biological systems. In this episode we talk about models of evolution help estimate transitions between states (e.g., nucleotide mutations) and fit the evolutionary patterns to build phylogenetic trees. Guests * Dr. Conor Meehan * Dr. Leo Martins Types of Models Broad Categories: Models can vary based on: - Transition probabilities (e.g., from one nucleotide to another). - Covariance among sites (heterogeneity across sites). - Specific models discussed include: - CAT Models: Different implementations for nucleotide or amino acid data. - Gamma-Distributed Models: Addressing rate variation across sites. - Best Model Selection: Determined by model testing rather than a one-size-fits-all approach. The best model depends on the dataset. Historical Context Model Evolution: Discussion on the evolution of phylogenetic models, such as DNAML and Fast DNAML, leading... Read more at https://happykhan.com/microbinfie/mb-12-phylogenetics-with-the-arborists-part-2 tag:soundcloud,2010:tracks/719459716 https://soundcloud.com/microbinfie/11-phylogenetics-with-the-arborists-part1 Thu, 06 Feb 2020 06:00:00 GMT 00:23:30 Microbial Bioinformatics no 11 Phylogenetics with the arborists part 1 by Mic… The microbinfie podcast explores the complex world of phylogenetic tree construction, featuring expert insights into computational methods, data selection challenges, and evolving approaches in microbial genomics. Phylogenetics is crucial for understanding the evolutionary relationships among species and microorganisms. This episode delves into the methodologies used in microbial bioinformatics to construct phylogenetic trees, which visually illustrate these relationships. By analyzing genetic data, researchers can gain insights into species evolution and their connections over time. Guests * Dr. Conor Meehan * Dr. Leo Martins Key Concepts Phylogenetic Trees: A branching diagram showing the inferred evolutionary relationships among various biological species. Arborists: Specialists who "prune and nurture the trees," ensuring accurate representations of data. Microbial Bioinformatics: A field focusing on the application of bioinformatics techniques to understand microbial data. Methods in Phylogenetic Analysis Sequence Alignment: Aligning DNA, RNA, or protein sequences to identify regions of similarity. Tree Construction Methods: - Distance-based methods (e.g.,... Read more at https://happykhan.com/microbinfie/mb-11-phylogenetics-with-the-arborists-part-1 The microbinfie podcast explores the complex world of phylogenetic tree construction, featuring expert insights into computational methods, data selection challenges, and evolving approaches in microbial genomics. Phylogenetics is crucial for understanding the evolutionary relationships among species and microorganisms. This episode delves into the methodologies used in microbial bioinformatics to construct phylogenetic trees, which visually illustrate these relationships. By analyzing genetic data, researchers can gain insights into species evolution and their connections over time. Guests * Dr. Conor Meehan * Dr. Leo Martins Key Concepts Phylogenetic Trees: A branching diagram showing the inferred evolutionary relationships among various biological species. Arborists: Specialists who "prune and nurture the trees," ensuring accurate representations of data. Microbial Bioinformatics: A field focusing on the application of bioinformatics techniques to understand microbial data. Methods in Phylogenetic Analysis Sequence Alignment: Aligning DNA, RNA, or protein sequences to identify regions of similarity. Tree Construction Methods: - Distance-based methods (e.g.,... Read more at https://happykhan.com/microbinfie/mb-11-phylogenetics-with-the-arborists-part-1 tag:soundcloud,2010:tracks/719278054 https://soundcloud.com/microbinfie/10-history-of-file-formats Thu, 23 Jan 2020 06:00:00 GMT 00:40:21 Microbial Bioinformatics no 10 History of file formats by Microbial Bioinform… The microbinfie podcast explores the complex landscape of file formats in microbial bioinformatics, revealing the evolution of data storage and sharing technologies across different sequencing platforms and research needs. Understanding the history and development of file formats in microbial bioinformatics is essential for researchers in the field. File formats are pivotal in storing, sharing, and analyzing vast amounts of biological data efficiently. Below is an overview of some critical milestones and formats that have shaped microbial bioinformatics. FASTA Format The FASTA format, developing in the 1980s, remains one of the most widely used formats for sequence data. It is simple and versatile, representing nucleotide or peptide sequences in text format. Its introduction allowed for the easy search and retrieval of sequence data. Example format: ` >Sequence_Name AGCTAGCTAGCTACGAACTTG ` FASTQ Format Introduced in the early 2000s, the FASTQ format addresses the need to capture quality scores along with sequence data, important... Read more at https://happykhan.com/microbinfie/mb-10-history-of-file-formats The microbinfie podcast explores the complex landscape of file formats in microbial bioinformatics, revealing the evolution of data storage and sharing technologies across different sequencing platforms and research needs. Understanding the history and development of file formats in microbial bioinformatics is essential for researchers in the field. File formats are pivotal in storing, sharing, and analyzing vast amounts of biological data efficiently. Below is an overview of some critical milestones and formats that have shaped microbial bioinformatics. FASTA Format The FASTA format, developing in the 1980s, remains one of the most widely used formats for sequence data. It is simple and versatile, representing nucleotide or peptide sequences in text format. Its introduction allowed for the easy search and retrieval of sequence data. Example format: ` >Sequence_Name AGCTAGCTAGCTACGAACTTG ` FASTQ Format Introduced in the early 2000s, the FASTQ format addresses the need to capture quality scores along with sequence data, important... Read more at https://happykhan.com/microbinfie/mb-10-history-of-file-formats tag:soundcloud,2010:tracks/727541380 https://soundcloud.com/microbinfie/09-nobel-prize-or-contamination Thu, 09 Jan 2020 06:00:06 GMT 00:39:53 Microbial Bioinformatics no Have you made a nobel prize winning discovery, or… The microbinfie podcast explores the critical challenge of contamination in genome sequencing, revealing how seemingly groundbreaking research can be derailed by undetected sample impurities. In the world of genome sequencing, identifying a groundbreaking discovery that could win a Nobel Prize can sometimes be derailed by something as mundane as contamination. Whether you are using short reads or long reads, understanding and mitigating contamination is crucial to ensure the accuracy and reliability of your data. Contamination can originate from several sources, and recognizing these can aid in developing strategies to minimize their impact. Here we discuss common sources: Environmental Contamination Environmental factors can introduce undesired DNA into samples, especially if the sequencing facility is not sufficiently controlled. Dust, skin cells, or microorganisms present in the air or on surfaces can be potential contaminants. Cross-Contamination Between Samples During sample preparation, it is possible for DNA from one sample to inadvertently transfer to... Read more at https://happykhan.com/microbinfie/mb-09-nobel-prize-or-contamination The microbinfie podcast explores the critical challenge of contamination in genome sequencing, revealing how seemingly groundbreaking research can be derailed by undetected sample impurities. In the world of genome sequencing, identifying a groundbreaking discovery that could win a Nobel Prize can sometimes be derailed by something as mundane as contamination. Whether you are using short reads or long reads, understanding and mitigating contamination is crucial to ensure the accuracy and reliability of your data. Contamination can originate from several sources, and recognizing these can aid in developing strategies to minimize their impact. Here we discuss common sources: Environmental Contamination Environmental factors can introduce undesired DNA into samples, especially if the sequencing facility is not sufficiently controlled. Dust, skin cells, or microorganisms present in the air or on surfaces can be potential contaminants. Cross-Contamination Between Samples During sample preparation, it is possible for DNA from one sample to inadvertently transfer to... Read more at https://happykhan.com/microbinfie/mb-09-nobel-prize-or-contamination tag:soundcloud,2010:tracks/732647680 https://soundcloud.com/microbinfie/looking-back-at-the Thu, 26 Dec 2019 06:30:43 GMT 00:36:16 Microbial Bioinformatics no So it's the end of 2019 and we thought we'd like … In the microbinfie podcast's year-end review episode, the hosts reflect on significant developments in microbial bioinformatics during 2019, highlighting technological advancements, collaborative research, and emerging trends in computational biology. As we close out 2019, it's a perfect time to pause and reflect on the projects we've been immersed in, evaluate what has resonated with us throughout the year, and consider the future trajectory of microbial bioinformatics. Key Highlights of 2019 Innovative Methodologies: This year saw the development of new methodologies that enhanced data analysis in microbial bioinformatics. Tools that accelerated genome sequencing and improved accuracy in metagenomic studies were particularly notable. Collaborative Research: Collaboration across disciplines and with international partners allowed for a more interdisciplinary approach to solving complex problems in microbial communities and their roles in ecosystems. Increased Data Accessibility: Efforts to make genomic data more accessible and user-friendly had a significant impact on research productivity, opening doors for... Read more at https://happykhan.com/microbinfie/mb-08-looking-back-at-2019 In the microbinfie podcast's year-end review episode, the hosts reflect on significant developments in microbial bioinformatics during 2019, highlighting technological advancements, collaborative research, and emerging trends in computational biology. As we close out 2019, it's a perfect time to pause and reflect on the projects we've been immersed in, evaluate what has resonated with us throughout the year, and consider the future trajectory of microbial bioinformatics. Key Highlights of 2019 Innovative Methodologies: This year saw the development of new methodologies that enhanced data analysis in microbial bioinformatics. Tools that accelerated genome sequencing and improved accuracy in metagenomic studies were particularly notable. Collaborative Research: Collaboration across disciplines and with international partners allowed for a more interdisciplinary approach to solving complex problems in microbial communities and their roles in ecosystems. Increased Data Accessibility: Efforts to make genomic data more accessible and user-friendly had a significant impact on research productivity, opening doors for... Read more at https://happykhan.com/microbinfie/mb-08-looking-back-at-2019 tag:soundcloud,2010:tracks/719276641 https://soundcloud.com/microbinfie/07-wham-bam-thank-you-sam Thu, 12 Dec 2019 06:00:03 GMT 00:33:40 Microbial Bioinformatics no This episode we discuss the ubiquitous Sequence A… The microbinfie podcast explores the evolution and significance of the Sequence Alignment Map (SAM) format, a critical standard in bioinformatics for managing complex genomic alignment data. In this episode, we delve into the widely used Sequence Alignment Map (SAM) format. This format is essential for storing biological sequence alignment data. The episode focuses on the SAM format, a standard file format used in bioinformatics for storing alignment information between sequencing reads and reference genomes. SAM (Sequence Alignment/Map) was created by Heng Li at the Sanger Institute in 2009, and is widely used in combination with tools like BWA for aligning short reads. SAM is a plain-text format for human readability. BAM is the binary version of SAM, designed for faster processing. CRAM is a compressed format, allowing for lossy or lossless data storage. These formats help manage the increasing data generated from modern sequencing technologies, especially short-read sequencing. Before the... Read more at https://happykhan.com/microbinfie/mb-07-wham-bam-thank-you-sam The microbinfie podcast explores the evolution and significance of the Sequence Alignment Map (SAM) format, a critical standard in bioinformatics for managing complex genomic alignment data. In this episode, we delve into the widely used Sequence Alignment Map (SAM) format. This format is essential for storing biological sequence alignment data. The episode focuses on the SAM format, a standard file format used in bioinformatics for storing alignment information between sequencing reads and reference genomes. SAM (Sequence Alignment/Map) was created by Heng Li at the Sanger Institute in 2009, and is widely used in combination with tools like BWA for aligning short reads. SAM is a plain-text format for human readability. BAM is the binary version of SAM, designed for faster processing. CRAM is a compressed format, allowing for lossy or lossless data storage. These formats help manage the increasing data generated from modern sequencing technologies, especially short-read sequencing. Before the... Read more at https://happykhan.com/microbinfie/mb-07-wham-bam-thank-you-sam tag:soundcloud,2010:tracks/679080552 https://soundcloud.com/microbinfie/05-writing-good-bioinformatics-software-with-torsten-seemann Thu, 28 Nov 2019 08:00:03 GMT 00:43:46 Microbial Bioinformatics no Torsten Seemann joins us to discuss how to write … In this episode of the microbinfie podcast, Associate Professor Torsten Seemann shares insights into developing effective bioinformatics software, drawing from his extensive experience creating widely-used tools like Prokka, Snippy, and Barrnap. Join us for an insightful discussion with Torsten Seemann, a renowned bioinformatician and software developer. Torsten is the author of several widely-used bioinformatics tools that have contributed significantly to the field. His notable tools include: Prokka: Rapid prokaryotic genome annotation. Snippy: Efficient variant calling and core genome alignment. Barrnap: Fast ribosomal RNA prediction. Abricate: Mass screening of contigs for antimicrobial resistance or virulence genes using BLAST. Shovill: Assembler and pipeline for assembling bacterial isolate Illumina reads. Nullarbor: A pipeline for bacterial genome assembly, annotation, and reporting. For more information and to explore Torsten's work, visit his GitHub page. Key Points Principles of Good Bioinformatics Software Focus on creating robust, user-friendly tools that solve real research problems Prioritize simplicity, minimal... Read more at https://happykhan.com/microbinfie/mb-06-writing-good-bioinformatics-software-with-torsten-seemann In this episode of the microbinfie podcast, Associate Professor Torsten Seemann shares insights into developing effective bioinformatics software, drawing from his extensive experience creating widely-used tools like Prokka, Snippy, and Barrnap. Join us for an insightful discussion with Torsten Seemann, a renowned bioinformatician and software developer. Torsten is the author of several widely-used bioinformatics tools that have contributed significantly to the field. His notable tools include: Prokka: Rapid prokaryotic genome annotation. Snippy: Efficient variant calling and core genome alignment. Barrnap: Fast ribosomal RNA prediction. Abricate: Mass screening of contigs for antimicrobial resistance or virulence genes using BLAST. Shovill: Assembler and pipeline for assembling bacterial isolate Illumina reads. Nullarbor: A pipeline for bacterial genome assembly, annotation, and reporting. For more information and to explore Torsten's work, visit his GitHub page. Key Points Principles of Good Bioinformatics Software Focus on creating robust, user-friendly tools that solve real research problems Prioritize simplicity, minimal... Read more at https://happykhan.com/microbinfie/mb-06-writing-good-bioinformatics-software-with-torsten-seemann tag:soundcloud,2010:tracks/678649521 https://soundcloud.com/microbinfie/05-history-of-genotyping-decentralised-future Thu, 14 Nov 2019 09:00:03 GMT 00:23:51 Microbial Bioinformatics no Modern genotyping is discussed in this second par… In this episode, we explore the advancements and methodologies involved in modern genotyping. This involves the use of cutting-edge technologies and techniques to investigate the genetic makeup of organisms. Key Points Data Privacy and Metadata Challenges Genetic data and minimal metadata can potentially reveal individual identities Different institutions have varying privacy and sharing guidelines Anonymization requires careful consideration of potential re-identification risks Global Collaboration Platforms Multiple international platforms like GMI, GenFS, IRIDA, and Innuendo facilitate genomic data sharing Standardization of metadata reporting remains a significant challenge Platforms aim to enable cross-institutional research and communication Decentralized Data Approaches Moving away from monolithic central databases to more flexible systems Local processing and storage with centralized aggregation points Addressing logistical and computational constraints of data management Take-Home Messages Metadata standardization is crucial for effective scientific collaboration Privacy protection must be balanced with research needs Technological platforms are evolving to support more flexible, secure... Read more at https://happykhan.com/microbinfie/mb-05-history-of-genotyping-decentralised-future In this episode, we explore the advancements and methodologies involved in modern genotyping. This involves the use of cutting-edge technologies and techniques to investigate the genetic makeup of organisms. Key Points Data Privacy and Metadata Challenges Genetic data and minimal metadata can potentially reveal individual identities Different institutions have varying privacy and sharing guidelines Anonymization requires careful consideration of potential re-identification risks Global Collaboration Platforms Multiple international platforms like GMI, GenFS, IRIDA, and Innuendo facilitate genomic data sharing Standardization of metadata reporting remains a significant challenge Platforms aim to enable cross-institutional research and communication Decentralized Data Approaches Moving away from monolithic central databases to more flexible systems Local processing and storage with centralized aggregation points Addressing logistical and computational constraints of data management Take-Home Messages Metadata standardization is crucial for effective scientific collaboration Privacy protection must be balanced with research needs Technological platforms are evolving to support more flexible, secure... Read more at https://happykhan.com/microbinfie/mb-05-history-of-genotyping-decentralised-future tag:soundcloud,2010:tracks/678648705 https://soundcloud.com/microbinfie/02-history-of-genotyping-the-early-years Thu, 31 Oct 2019 09:00:02 GMT 00:28:39 Microbial Bioinformatics no Genotyping is at the foundation of modern microbi… The microbinfie podcast explores the evolution of microbial typing methods, tracing the journey from traditional techniques to whole genome sequencing (WGS) approaches in microbial characterization and outbreak surveillance. Key Points Traditional Microbial Typing Methods Techniques like serotyping, phage typing, and plasmid typing were critical for identifying and tracking microbes Methods such as PFGE, MILVA, and MLST provided crucial insights before WGS era Many classic methods remain valuable for specific applications and outbreak investigations Transition to Whole Genome Sequencing Surveillance platforms are progressively shifting from traditional methods to WGS CDC began transitioning to WGS for organisms like Listeria (2013) and Salmonella Genome databases like NCBI and ENA now facilitate widespread data sharing Epidemiological Applications Microbial typing methods help link outbreaks, identify host niches, and characterize virulence genes Techniques can reveal geographic distributions and strain-specific characteristics Profiling methods continue to provide valuable contextual information Take-Home Messages Traditional typing methods remain scientifically relevant... Read more at https://happykhan.com/microbinfie/mb-04-history-of-genotyping-the-early-years The microbinfie podcast explores the evolution of microbial typing methods, tracing the journey from traditional techniques to whole genome sequencing (WGS) approaches in microbial characterization and outbreak surveillance. Key Points Traditional Microbial Typing Methods Techniques like serotyping, phage typing, and plasmid typing were critical for identifying and tracking microbes Methods such as PFGE, MILVA, and MLST provided crucial insights before WGS era Many classic methods remain valuable for specific applications and outbreak investigations Transition to Whole Genome Sequencing Surveillance platforms are progressively shifting from traditional methods to WGS CDC began transitioning to WGS for organisms like Listeria (2013) and Salmonella Genome databases like NCBI and ENA now facilitate widespread data sharing Epidemiological Applications Microbial typing methods help link outbreaks, identify host niches, and characterize virulence genes Techniques can reveal geographic distributions and strain-specific characteristics Profiling methods continue to provide valuable contextual information Take-Home Messages Traditional typing methods remain scientifically relevant... Read more at https://happykhan.com/microbinfie/mb-04-history-of-genotyping-the-early-years tag:soundcloud,2010:tracks/678621687 https://soundcloud.com/microbinfie/fastq-all-your-bases Thu, 17 Oct 2019 08:00:02 GMT 00:18:17 Microbial Bioinformatics no FASTQ files are the foundation of modern bioinfor… In this episode of the microbinfie podcast, the hosts dive deep into the world of FASTQ files, exploring their evolution, technical intricacies, and critical role in modern genomic sequencing. The discussion traverses the historical development of sequence file formats, highlighting the transition from proprietary technologies to the now-ubiquitous FASTQ standard. Key Points FASTQ File Origins and Significance Emerged from Sanger Institute as a standardized format for storing DNA sequence data Introduced quality scores to enhance sequence accuracy and reliability Replaced earlier proprietary formats like SFS and SFF Technical Nuances of FASTQ Uses ASCII-based encoding for quality scores (Sanger offset 33, Pred64 offset 64) Handles complex metadata through detailed file headers Challenges include encoding variations, quality score binning, and multi-line parsing Modern Sequencing Technologies Adapting to new sequencing platforms like PacBio and Nanopore Ongoing challenges with quality score encoding and bioinformatics tool compatibility Continued importance despite emergence of alignment formats like... Read more at https://happykhan.com/microbinfie/mb-03-fastq-all-your-bases-are-belong-to-us In this episode of the microbinfie podcast, the hosts dive deep into the world of FASTQ files, exploring their evolution, technical intricacies, and critical role in modern genomic sequencing. The discussion traverses the historical development of sequence file formats, highlighting the transition from proprietary technologies to the now-ubiquitous FASTQ standard. Key Points FASTQ File Origins and Significance Emerged from Sanger Institute as a standardized format for storing DNA sequence data Introduced quality scores to enhance sequence accuracy and reliability Replaced earlier proprietary formats like SFS and SFF Technical Nuances of FASTQ Uses ASCII-based encoding for quality scores (Sanger offset 33, Pred64 offset 64) Handles complex metadata through detailed file headers Challenges include encoding variations, quality score binning, and multi-line parsing Modern Sequencing Technologies Adapting to new sequencing platforms like PacBio and Nanopore Ongoing challenges with quality score encoding and bioinformatics tool compatibility Continued importance despite emergence of alignment formats like... Read more at https://happykhan.com/microbinfie/mb-03-fastq-all-your-bases-are-belong-to-us tag:soundcloud,2010:tracks/679961924 https://soundcloud.com/microbinfie/what-software-not-to-write Thu, 03 Oct 2019 07:00:04 GMT 00:21:27 Microbial Bioinformatics no In this episode we identify areas of “Peak-bioinf… The microbinfie podcast delves into the complexities of bioinformatics software development, emphasizing the importance of avoiding redundant tool creation in metagenomics and antimicrobial resistance (AMR) research. The discussion critically examines the current landscape of bioinformatics tools, highlighting the need for optimization and strategic innovation. Key Points Metagenomics Tool Landscape 16S sequencing is considered outdated compared to shotgun metagenomics Existing taxonomic classification tools (Kraken, Megan, MetaPhlAn) offer diverse approaches Long-read sequencing provides more comprehensive genomic insights Antimicrobial Resistance (AMR) Challenges Multiple competing AMR databases lack standardization Inconsistent naming conventions and data curation are significant issues International consortia are attempting to create consensus Tool Development Recommendations Focus on optimizing existing tools rather than creating new ones Explore innovative approaches like GPU/FPGA computing Prioritize long-read sequencing and mobile genetic element analysis Take-Home Messages Avoid creating redundant bioinformatics tools Contribute to existing repositories and databases Embrace new sequencing technologies and computational approaches When Novel... Read more at https://happykhan.com/microbinfie/mb-02-what-bioinformatics-software-not-to-write-part-2 The microbinfie podcast delves into the complexities of bioinformatics software development, emphasizing the importance of avoiding redundant tool creation in metagenomics and antimicrobial resistance (AMR) research. The discussion critically examines the current landscape of bioinformatics tools, highlighting the need for optimization and strategic innovation. Key Points Metagenomics Tool Landscape 16S sequencing is considered outdated compared to shotgun metagenomics Existing taxonomic classification tools (Kraken, Megan, MetaPhlAn) offer diverse approaches Long-read sequencing provides more comprehensive genomic insights Antimicrobial Resistance (AMR) Challenges Multiple competing AMR databases lack standardization Inconsistent naming conventions and data curation are significant issues International consortia are attempting to create consensus Tool Development Recommendations Focus on optimizing existing tools rather than creating new ones Explore innovative approaches like GPU/FPGA computing Prioritize long-read sequencing and mobile genetic element analysis Take-Home Messages Avoid creating redundant bioinformatics tools Contribute to existing repositories and databases Embrace new sequencing technologies and computational approaches When Novel... Read more at https://happykhan.com/microbinfie/mb-02-what-bioinformatics-software-not-to-write-part-2 tag:soundcloud,2010:tracks/679961927 https://soundcloud.com/microbinfie/what-software-not-to-write-1 Thu, 19 Sep 2019 00:00:00 GMT 00:23:52 Microbial Bioinformatics no In this episode we identify areas of “Peak-bioinf… In the inaugural episode of the microbinfie podcast, hosts explore the landscape of bioinformatics software development, critically examining areas where new tools may be unnecessary or redundant. Key Points Software Redundancy in Bioinformatics Many existing bioinformatics tools already solve specific computational problems New software development should focus on genuine innovation rather than reinventing existing solutions Researchers often continue using tools even after technologies become obsolete Areas of Established Software Multiple sequence alignment tools like MAFFT and MUSCLE remain foundational Genome assemblers such as SPAdes, Velvet, and long-read tools like Canu have mature implementations Read mapping and variant calling tools offer robust, well-established pipelines Technological Evolution Microarray technology exemplifies how research tools can become outdated Transitioning between sequencing technologies requires careful assessment of available tools Workflow managers increasingly help integrate various bioinformatics tools Take-Home Messages Always conduct a thorough literature review before developing new bioinformatics tools Recognize when existing software adequately... Read more at https://happykhan.com/microbinfie/mb-01-what-bioinformatics-software-not-to-write-part-1 In the inaugural episode of the microbinfie podcast, hosts explore the landscape of bioinformatics software development, critically examining areas where new tools may be unnecessary or redundant. Key Points Software Redundancy in Bioinformatics Many existing bioinformatics tools already solve specific computational problems New software development should focus on genuine innovation rather than reinventing existing solutions Researchers often continue using tools even after technologies become obsolete Areas of Established Software Multiple sequence alignment tools like MAFFT and MUSCLE remain foundational Genome assemblers such as SPAdes, Velvet, and long-read tools like Canu have mature implementations Read mapping and variant calling tools offer robust, well-established pipelines Technological Evolution Microarray technology exemplifies how research tools can become outdated Transitioning between sequencing technologies requires careful assessment of available tools Workflow managers increasingly help integrate various bioinformatics tools Take-Home Messages Always conduct a thorough literature review before developing new bioinformatics tools Recognize when existing software adequately... Read more at https://happykhan.com/microbinfie/mb-01-what-bioinformatics-software-not-to-write-part-1 tag:soundcloud,2010:tracks/682433045 https://soundcloud.com/microbinfie/trailer Tue, 17 Sep 2019 00:00:00 GMT 00:00:51 Microbial Bioinformatics no The Micro Binfie poscast is available at SoundClo… Micro Binfie Podcast The Micro Binfie podcast is available on several platforms: SoundCloud: Listen here iTunes: Subscribe here Spotify: Listen here You can also subscribe using your favorite podcast software. Micro Binfie Podcast The Micro Binfie podcast is available on several platforms: SoundCloud: Listen here iTunes: Subscribe here Spotify: Listen here You can also subscribe using your favorite podcast software.