pKP1-NDM-1.aries (FASTA)

FASTA files start with a header line starting with '>', followed by the sequence data.

>KF992018.2 Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence
GATAGGCTCAGATAAACAGACCTTACCCTCGCATCGAGAACCGCTTGCCCTCCAGCATCGAGAGACGGTG

pKP1-NDM-1.cancer (SAM)

SAM files start with a header line starting with '@', followed by the sequence data. SAM format is fairly complicated, but there is detailed specification online, https://en.wikipedia.org/wiki/SAM_(file_format).

@HD     VN:1.6  SO:unsorted     GO:query
@SQ     SN:KJ802404.1   LN:166750
@PG     ID:minimap2     PN:minimap2     VN:2.26-r1175   CL:minimap2 -ax sr ref.fasta
KF992018.2-55020        83      KJ802404.1      125388  60      150M    =       125339  -199

pKP1-NDM-1.gemini (BAM)

BAM files start with a header line starting with '@', followed by the mapping data. This one is tricky, because it is a binary file in its own format. To figure this out:

head pKP1-NDM-1.gemini 
zcat pKP1-NDM-1.gemini | more 
samtools view pKP1-NDM-1.gemini | more 

The zcat output looked like a slightly garbled bam file. To work with bam files it is best to use samtools view. You may need to install samtools via conda.

pKP1-NDM-1.leo (BED)

This is a BED file. BED files, like quite a few formats, are a tabular (tab-delimited) table.

A typical BED file contains the following columns:

• Chromosome: The name of the chromosome or sequence where the feature is located.
• Start Position: The starting position of the feature on the chromosome, typically a 0-based coordinate.
• End Position: The ending position of the feature on the chromosome, also in 0-based coordinate.
• Name/ID: A user-defined name or identifier for the feature (optional).
• Score: A numeric value associated with the feature (optional).
• Strand: Indicates the strand of the DNA (either "+" for forward or "-" for reverse) where the feature is located (optional).

KJ802404.1      0       115     KF992018.2-51862/1      60      +
KJ802404.1      0       100     KF992018.2-50856/1      60      +
KJ802404.1      0       60      KF992018.2-41754/2      60      +

pKP1-NDM-1.libra (GFF)

This is a GFF file. This is another tabular file format, but with a different structure to BED files. Much of the information is the same and it can be hard to tell the difference.

A typical GFF file contains tab-delimited fields:

• Sequence or Reference Identifier
• Source: The source of the feature's annotation data
• Feature Type: Describes the type of genomic feature (e.g., gene, exon, mRNA, CDS)
• Start Position (1-based)
• End Position (inclusive, 1-based)
• Score (optional)
• Strand: + for forward, - for reverse, or . for unknown
• Frame: Reading frame (optional)

KJ802404.1      bed2gff KF992018.2-51862/1      1       115     60      +       .
KJ802404.1      bed2gff KF992018.2-50856/1      1       100     60      +       .

pKP1-NDM-1.pisces (VCF)

This is a VCF file. The # denote header lines, the #CHROM line is the header line for the data. The actual data, which are variant calls, follows after and is tab-delimited. See https://en.wikipedia.org/wiki/Variant_Call_Format for details.

##fileformat=VCFv4.2
##FILTER=<ID=PASS,Description="All filters passed">
##samtoolsVersion=1.9+htslib-1.9
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT
KJ802404.1      1       .       N       A,<*>   0       .       DP=25

pKP1-NDM-1_R1.capricorn (FASTA.gz)

This is a binary file, a gzip file specifically. zcat will show us that it is a FASTA file as we saw before. The headers and the sequence length suggests it was a FASTQ file, but the quality scores are now removed.

>KF992018.2-55020/1
CCGGAGCTGGCATGTCTGAAAACTCCTGACGCCCAGCCGCCACCTATAGCCCCAATCGCTCCGGCGATTCCAACTTTTGA
CCAACTAACACATTTCCAACTCCCATTATTTTCGATTAGTTGGCTAAGTAGCTCCAACCCAGCTCCAATA

pKP1-NDM-1.scorpio (FASTQ.gz)

This is a compressed (gzipped) FASTQ file. We need zcat or similar to handle the file compression. You may have noticed the /2 at the end of each header. This is a convention that tells us this is the mate pair (R2) of a paired-end read. This convention is not always enforced, so I would ask the person who gave me the file to confirm.

@KF992018.2-55020/2
CTATGTCCAATACCGACCCGACGGGTGAATTTGCGTTTGTTGGTGCAGGTATTGGCGCTGGGTTGGAGCTACTTAGCCAA
CTAATCGAAAATAATGGGAGTTGGAAATGTGTTAGTTGGTCAAAAGTTGGAATCGCCGGAGCGATTGGGG
+
1CCGGGGGGCGGGJCJJJJ1JJJGJJGJJJGJ1CGJGJGCJC=GJC1CJGCGGCJ(=JGJGJJG1=GGJGGGGGGGGGGG

pKP1-NDM-1.taurus (BCF)

This is a compressed VCF file, i.e. a BCF file. We can view the contents with zcat or similar. We can also use bcftools view or bcftools query (the same way we do with SAM/BAM).

pKP1-NDM-1.virgo (FASTQ.gz)

This is a compressed FASTQ file. We can view the contents with zcat or similar. You may have noticed the /1 at the end of each header. This is a convention that tells us this is the first read pair (R1) of a paired-end read.

As you get more familiar with data from a specific organism or datatype, you may be able to identify the type of data simply by the file size. For example, for what I do, a 300MB file is likely to be a FASTQ file, while a 1MB file is likely to be a VCF file.